ID: 1165279247

View in Genome Browser
Species Human (GRCh38)
Location 19:34782650-34782672
Sequence CTGTCCTCACAGCTGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165279247_1165279254 -2 Left 1165279247 19:34782650-34782672 CCATGCTCCAGCTGTGAGGACAG No data
Right 1165279254 19:34782671-34782693 AGAGCCGCCTCTGGGGCAAGGGG No data
1165279247_1165279253 -3 Left 1165279247 19:34782650-34782672 CCATGCTCCAGCTGTGAGGACAG No data
Right 1165279253 19:34782670-34782692 CAGAGCCGCCTCTGGGGCAAGGG No data
1165279247_1165279258 19 Left 1165279247 19:34782650-34782672 CCATGCTCCAGCTGTGAGGACAG No data
Right 1165279258 19:34782692-34782714 GGACAGGAAGAAACCAGCTCAGG No data
1165279247_1165279260 28 Left 1165279247 19:34782650-34782672 CCATGCTCCAGCTGTGAGGACAG No data
Right 1165279260 19:34782701-34782723 GAAACCAGCTCAGGTCACTAGGG No data
1165279247_1165279251 -9 Left 1165279247 19:34782650-34782672 CCATGCTCCAGCTGTGAGGACAG No data
Right 1165279251 19:34782664-34782686 TGAGGACAGAGCCGCCTCTGGGG No data
1165279247_1165279252 -4 Left 1165279247 19:34782650-34782672 CCATGCTCCAGCTGTGAGGACAG No data
Right 1165279252 19:34782669-34782691 ACAGAGCCGCCTCTGGGGCAAGG No data
1165279247_1165279256 3 Left 1165279247 19:34782650-34782672 CCATGCTCCAGCTGTGAGGACAG No data
Right 1165279256 19:34782676-34782698 CGCCTCTGGGGCAAGGGGACAGG No data
1165279247_1165279250 -10 Left 1165279247 19:34782650-34782672 CCATGCTCCAGCTGTGAGGACAG No data
Right 1165279250 19:34782663-34782685 GTGAGGACAGAGCCGCCTCTGGG No data
1165279247_1165279259 27 Left 1165279247 19:34782650-34782672 CCATGCTCCAGCTGTGAGGACAG No data
Right 1165279259 19:34782700-34782722 AGAAACCAGCTCAGGTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165279247 Original CRISPR CTGTCCTCACAGCTGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr