ID: 1165279254

View in Genome Browser
Species Human (GRCh38)
Location 19:34782671-34782693
Sequence AGAGCCGCCTCTGGGGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165279246_1165279254 -1 Left 1165279246 19:34782649-34782671 CCCATGCTCCAGCTGTGAGGACA No data
Right 1165279254 19:34782671-34782693 AGAGCCGCCTCTGGGGCAAGGGG No data
1165279242_1165279254 25 Left 1165279242 19:34782623-34782645 CCAGGACAGCAGAGAAGTGAGAA No data
Right 1165279254 19:34782671-34782693 AGAGCCGCCTCTGGGGCAAGGGG No data
1165279247_1165279254 -2 Left 1165279247 19:34782650-34782672 CCATGCTCCAGCTGTGAGGACAG No data
Right 1165279254 19:34782671-34782693 AGAGCCGCCTCTGGGGCAAGGGG No data
1165279248_1165279254 -9 Left 1165279248 19:34782657-34782679 CCAGCTGTGAGGACAGAGCCGCC No data
Right 1165279254 19:34782671-34782693 AGAGCCGCCTCTGGGGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165279254 Original CRISPR AGAGCCGCCTCTGGGGCAAG GGG Intergenic
No off target data available for this crispr