ID: 1165279259

View in Genome Browser
Species Human (GRCh38)
Location 19:34782700-34782722
Sequence AGAAACCAGCTCAGGTCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165279255_1165279259 2 Left 1165279255 19:34782675-34782697 CCGCCTCTGGGGCAAGGGGACAG No data
Right 1165279259 19:34782700-34782722 AGAAACCAGCTCAGGTCACTAGG No data
1165279248_1165279259 20 Left 1165279248 19:34782657-34782679 CCAGCTGTGAGGACAGAGCCGCC No data
Right 1165279259 19:34782700-34782722 AGAAACCAGCTCAGGTCACTAGG No data
1165279257_1165279259 -1 Left 1165279257 19:34782678-34782700 CCTCTGGGGCAAGGGGACAGGAA No data
Right 1165279259 19:34782700-34782722 AGAAACCAGCTCAGGTCACTAGG No data
1165279246_1165279259 28 Left 1165279246 19:34782649-34782671 CCCATGCTCCAGCTGTGAGGACA No data
Right 1165279259 19:34782700-34782722 AGAAACCAGCTCAGGTCACTAGG No data
1165279247_1165279259 27 Left 1165279247 19:34782650-34782672 CCATGCTCCAGCTGTGAGGACAG No data
Right 1165279259 19:34782700-34782722 AGAAACCAGCTCAGGTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165279259 Original CRISPR AGAAACCAGCTCAGGTCACT AGG Intergenic
No off target data available for this crispr