ID: 1165279767

View in Genome Browser
Species Human (GRCh38)
Location 19:34786018-34786040
Sequence GGCAGAACCCCCATTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165279758_1165279767 26 Left 1165279758 19:34785969-34785991 CCAAGATATCATGGGATGGAGTG No data
Right 1165279767 19:34786018-34786040 GGCAGAACCCCCATTTCAGGAGG No data
1165279757_1165279767 27 Left 1165279757 19:34785968-34785990 CCCAAGATATCATGGGATGGAGT No data
Right 1165279767 19:34786018-34786040 GGCAGAACCCCCATTTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165279767 Original CRISPR GGCAGAACCCCCATTTCAGG AGG Intergenic
No off target data available for this crispr