ID: 1165279924

View in Genome Browser
Species Human (GRCh38)
Location 19:34787038-34787060
Sequence CTGTGGGGCTGGGGCCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165279913_1165279924 3 Left 1165279913 19:34787012-34787034 CCCACCAAAACCTAGTGAATCAG No data
Right 1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG No data
1165279915_1165279924 -1 Left 1165279915 19:34787016-34787038 CCAAAACCTAGTGAATCAGAAAC No data
Right 1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG No data
1165279917_1165279924 -7 Left 1165279917 19:34787022-34787044 CCTAGTGAATCAGAAACTGTGGG No data
Right 1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG No data
1165279912_1165279924 4 Left 1165279912 19:34787011-34787033 CCCCACCAAAACCTAGTGAATCA No data
Right 1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG No data
1165279911_1165279924 9 Left 1165279911 19:34787006-34787028 CCTGGCCCCACCAAAACCTAGTG No data
Right 1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG No data
1165279914_1165279924 2 Left 1165279914 19:34787013-34787035 CCACCAAAACCTAGTGAATCAGA No data
Right 1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG No data
1165279910_1165279924 10 Left 1165279910 19:34787005-34787027 CCCTGGCCCCACCAAAACCTAGT No data
Right 1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165279924 Original CRISPR CTGTGGGGCTGGGGCCCAGA GGG Intergenic
No off target data available for this crispr