ID: 1165282110

View in Genome Browser
Species Human (GRCh38)
Location 19:34806450-34806472
Sequence TTTCACTTTCTGATGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165282110_1165282113 -10 Left 1165282110 19:34806450-34806472 CCAAGCACCATCAGAAAGTGAAA No data
Right 1165282113 19:34806463-34806485 GAAAGTGAAACCGTGCCCCAGGG No data
1165282110_1165282114 -9 Left 1165282110 19:34806450-34806472 CCAAGCACCATCAGAAAGTGAAA No data
Right 1165282114 19:34806464-34806486 AAAGTGAAACCGTGCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165282110 Original CRISPR TTTCACTTTCTGATGGTGCT TGG (reversed) Intergenic
No off target data available for this crispr