ID: 1165282821

View in Genome Browser
Species Human (GRCh38)
Location 19:34812928-34812950
Sequence GCAGCTTGTGTTCTTGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165282818_1165282821 -5 Left 1165282818 19:34812910-34812932 CCTGCACCCAACTGATGAGCAGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1165282821 19:34812928-34812950 GCAGCTTGTGTTCTTGAATCTGG 0: 1
1: 0
2: 1
3: 4
4: 147
1165282816_1165282821 29 Left 1165282816 19:34812876-34812898 CCTTGAGACACACAGCTTTTGTA 0: 1
1: 0
2: 2
3: 13
4: 197
Right 1165282821 19:34812928-34812950 GCAGCTTGTGTTCTTGAATCTGG 0: 1
1: 0
2: 1
3: 4
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165282821 Original CRISPR GCAGCTTGTGTTCTTGAATC TGG Intergenic
905051388 1:35053964-35053986 GCAGCTTGACTTCTTGACTTGGG - Intergenic
906483835 1:46219734-46219756 GCAGCTGGTGACCTTGAATGAGG + Exonic
909239974 1:73200237-73200259 GCATCTACTGGTCTTGAATCTGG - Intergenic
911465149 1:98242520-98242542 TCAGGTTGTGTTTTTGAATTAGG - Intergenic
915662191 1:157413725-157413747 GCAGCTTGTGTGACTGAGTCTGG - Intergenic
920059162 1:203215804-203215826 GCAGCTTGTGCTCTGGACTGAGG + Intronic
920825286 1:209419248-209419270 GCAAACTGTGTGCTTGAATCTGG - Intergenic
921383398 1:214547363-214547385 GCAGCGTGTGTTCTTGAAACAGG - Intronic
923023521 1:230186201-230186223 GCACGTTGTGTTCTTGACTGTGG + Intronic
924952623 1:248898316-248898338 GCAGCATTTGGGCTTGAATCAGG + Intergenic
1065280235 10:24129907-24129929 GCAGCCTATGATCATGAATCTGG - Intronic
1066703814 10:38156863-38156885 GCACTTTCTGTTGTTGAATCCGG - Intergenic
1069238892 10:66113515-66113537 GCAGCGTTTGACCTTGAATCTGG - Intronic
1070239280 10:74662014-74662036 GGAGCTTATTTTCTTCAATCAGG - Intronic
1072093831 10:92157057-92157079 ACAGATTGTGATCTTGACTCTGG + Intronic
1075799428 10:125143876-125143898 GGAGCTTGTCTGCTTGAATATGG - Intronic
1075872425 10:125780520-125780542 GCAGCTTGGGTGCTTGACTTGGG + Intergenic
1077798814 11:5518070-5518092 GCAGCTTCTGCACTGGAATCAGG + Intronic
1078661990 11:13295224-13295246 GCAGCCTGTGTTCTAGATGCTGG + Intronic
1078954940 11:16182643-16182665 GCAACATGTGTACTTGAATATGG + Intronic
1085610457 11:77943807-77943829 GCAGTTTTTGTTCTTAAAGCAGG - Intronic
1091322387 11:134661000-134661022 GCAGCTTCTGTCCTTGACACCGG - Intergenic
1093930179 12:24948505-24948527 GCAGCGTGTGTTCGTGATGCAGG - Intronic
1094062769 12:26332483-26332505 CCAGCTTGTCTTCATGAGTCCGG + Intergenic
1097625305 12:61992761-61992783 GGAGCTTGTCTTCTTGCATAGGG - Intronic
1099014048 12:77324625-77324647 GCAGCCTGTGTTCTGCATTCTGG + Intergenic
1101406839 12:104436276-104436298 GAAGCTTATGTTCTTGAGTTGGG + Intergenic
1102966239 12:117129878-117129900 GCAGCTTGGGTTTTGGAGTCAGG + Intergenic
1107373676 13:39779316-39779338 GCATCTTTTGTTCTTGTCTCTGG - Intronic
1107658763 13:42617686-42617708 TCATCTTGTCTTCTGGAATCAGG - Intergenic
1111770957 13:92594990-92595012 GAAGCATGTGTTGTTGAACCAGG - Intronic
1112790889 13:103001271-103001293 GCAGCTTCTGTGCTTGCATGGGG - Intergenic
1113327644 13:109297784-109297806 GTGGTTTGTGTTCTTGCATCTGG + Intergenic
1114127361 14:19744742-19744764 GAAGCTGGTGTTTTTGAATGTGG + Intronic
1120941311 14:89952871-89952893 GCAGCTCAATTTCTTGAATCTGG + Intronic
1122481704 14:102051457-102051479 GCCGCTTGTGTTCTTGACCAGGG + Intergenic
1124659150 15:31531042-31531064 GCACCTTCTCTCCTTGAATCTGG + Intronic
1128530010 15:68438503-68438525 GGAGCTTGGGATCTGGAATCAGG - Intergenic
1131212128 15:90507000-90507022 TCAGTTTGTATTTTTGAATCAGG + Intergenic
1131537125 15:93246696-93246718 TCAGCTGGTGTTCCTGAATCAGG + Intergenic
1133930773 16:10230370-10230392 GGGGCTTATGTTCTTGAAGCAGG - Intergenic
1134277748 16:12791813-12791835 GCAGCTTTTATTATTGAGTCTGG + Intronic
1135622777 16:23970169-23970191 GCAGCTTGTGTGTTTGTATTTGG + Intronic
1138174093 16:54880479-54880501 GCTGCTGGTGTTCTGGAAGCAGG - Intergenic
1138431675 16:56972936-56972958 GCAGCTTGTTTTCCTGATTTTGG + Intronic
1138502499 16:57456389-57456411 GCAGCTTGATTTCTTCACTCTGG - Intronic
1138848210 16:60593387-60593409 GCAGCTTATTTTCTTCAGTCTGG - Intergenic
1142432520 16:90037631-90037653 GCTGCTTGTGTCCTGGAACCAGG + Intronic
1144138795 17:12325041-12325063 GGAGTTTGTGTTTTTGCATCCGG + Intergenic
1146548792 17:33762385-33762407 GGAGCTTGTATTCTGGAAGCAGG + Intronic
1146920474 17:36706770-36706792 GGAGCTTGAGTTCTAGAAACAGG + Intergenic
1147001642 17:37367442-37367464 ACAGCTTGAGCTCTTTAATCAGG + Intronic
1147256889 17:39186815-39186837 GCAGCTTCTGTTCCTGCAGCAGG + Exonic
1149416108 17:56461623-56461645 GCACCTTGTATTCTTCATTCAGG + Intronic
1150706417 17:67491230-67491252 GCAGCTGGTGCACTTGACTCTGG + Intronic
1153138920 18:1949567-1949589 GCAGCTAGTTTTCCTAAATCTGG - Intergenic
1159539748 18:69760574-69760596 GCAGCTTGACCTCTTGAATTCGG + Intronic
1165282821 19:34812928-34812950 GCAGCTTGTGTTCTTGAATCTGG + Intergenic
1165731869 19:38151110-38151132 GCAGCTTATGATGTTAAATCTGG + Intronic
1165757772 19:38304322-38304344 GCAGCTTCTGGGCTTGAGTCCGG - Intronic
1167207176 19:48110523-48110545 GGAGCTTGTGCTCCGGAATCCGG + Exonic
926143125 2:10380395-10380417 GCTGCTTGTGTTGTTGAATTGGG + Intronic
928234550 2:29528316-29528338 CAAGCTTGCGTTCTTGCATCCGG + Intronic
930355543 2:50314235-50314257 GAAGCTTGTCTTTTTGAAGCAGG - Intronic
930724976 2:54673887-54673909 GCATCCTGTGTTCTGGAGTCTGG + Intergenic
932851263 2:75189307-75189329 GCAGCTGAGGTTCTGGAATCAGG - Intronic
934753570 2:96809942-96809964 CCAGCTTGTGTCCCTGATTCAGG + Exonic
937795587 2:126014839-126014861 GGAGCTTGTGTTCTTGTAAAAGG - Intergenic
938410139 2:131056811-131056833 CCAGCATGTGTCCTTGTATCTGG - Intronic
939780733 2:146444515-146444537 CCATCTTGTGTTTTGGAATCTGG + Intergenic
939956671 2:148533185-148533207 GCAGCTTGTGTTTTTCAGACAGG - Intergenic
941512585 2:166431577-166431599 GCAGCTTGTGTTTTAGAAGGAGG - Intronic
943054745 2:182961947-182961969 ACTGTTTGTGTTCTTTAATCAGG - Intronic
946010923 2:216562901-216562923 GCCTCTTGTGTTGTTGATTCAGG - Intronic
946541937 2:220694354-220694376 GCTCTTTGTGTTCTTGAATGTGG - Intergenic
946992324 2:225348666-225348688 GCAGTTAGTTTTCTTGACTCAGG + Intergenic
947840887 2:233207331-233207353 GCAGCTTGTGTCACTGAAGCTGG - Exonic
948333610 2:237191071-237191093 GACTCTTGTGTTCTTGGATCAGG + Intergenic
1168788833 20:562581-562603 GCCTCTTCTGTTCTGGAATCAGG + Intergenic
1170170119 20:13401287-13401309 ACAGCTTTTGATCTTAAATCTGG + Intronic
1174035895 20:47668056-47668078 GCAATTTGTGTACTTGCATCGGG - Intronic
1175901020 20:62359965-62359987 GCAGCCTTTGTTCTGGGATCTGG - Intronic
1176913998 21:14603297-14603319 GCCTCCTGTGTTCTAGAATCTGG + Intronic
1177744727 21:25197899-25197921 GCAGGTTGTGTACTTCAGTCCGG + Intergenic
1179101199 21:38356958-38356980 GCATCTTTTCTTATTGAATCGGG - Intergenic
1180149902 21:45942185-45942207 CCAGGTTGTGTGCTGGAATCGGG + Exonic
1183127942 22:35803289-35803311 ACTGCTTATTTTCTTGAATCTGG - Intronic
955360736 3:58272307-58272329 ACAGCTTGGGTTCTGGAGTCAGG - Intronic
957592555 3:82219292-82219314 GCAGCTTGTATTCTAGATTCTGG + Intergenic
963487741 3:145957430-145957452 GCAGGTTGTGTTGCTGACTCAGG - Intergenic
965178905 3:165374993-165375015 GCAGCATGTGTTTCTAAATCTGG + Intergenic
968029277 3:195469225-195469247 GGAGCCTGTGCTCTTGAAGCAGG - Intergenic
969856607 4:10004854-10004876 GCAGATTGTTTTCTTCAAACAGG - Intronic
970310073 4:14773092-14773114 GGAGCTTGGGTTCTTGAAAATGG - Intergenic
970723839 4:19019349-19019371 TCAGCTTGTGTTTTTTCATCTGG + Intergenic
972759193 4:42085313-42085335 GGAGCTTGGGATCTGGAATCAGG + Intronic
973056389 4:45664561-45664583 GAAACTTGTGTTCTGGAATGAGG + Intergenic
977031303 4:91887936-91887958 ACAGCTTCTGTTCTTGTCTCTGG + Intergenic
978548543 4:109899776-109899798 GCAGCTTGAGTTCTTAGAACGGG - Intergenic
981240115 4:142466900-142466922 GCAGCTTGTGCTCTTCAAAGTGG - Intronic
986167708 5:5290205-5290227 CAAGCTTGTGTTCTTGCAGCTGG + Intronic
986662093 5:10068272-10068294 GTTGCTTGTTTTCTTGAATTAGG - Intergenic
987697479 5:21350725-21350747 GTAGCCTATGTTCTTGAATGTGG + Intergenic
988339704 5:29954474-29954496 GCTGCTTGTATTTTTTAATCTGG + Intergenic
988754759 5:34235962-34235984 GTAGCCTATGTTCTTGAATGCGG - Intergenic
990073200 5:51810354-51810376 GCAACTTTTCTTCTTGAGTCTGG - Intergenic
991742973 5:69701654-69701676 GTAGCCTATGTTCTTGAATGCGG - Intergenic
991754723 5:69853548-69853570 GTAGCCTATGTTCTTGAATGCGG + Intergenic
991794546 5:70281391-70281413 GTAGCCTATGTTCTTGAATGCGG - Intergenic
991822360 5:70576966-70576988 GTAGCCTATGTTCTTGAATGCGG - Intergenic
991834050 5:70728697-70728719 GTAGCCTATGTTCTTGAATGCGG + Intergenic
991886926 5:71280934-71280956 GTAGCCTATGTTCTTGAATGCGG - Intergenic
993873082 5:93274405-93274427 ACAGCTTGTGCCCCTGAATCAGG + Intergenic
994830579 5:104777113-104777135 GCAGCTTGAGTTATTGAAGAAGG + Intergenic
995382769 5:111553093-111553115 GCAGCTTGTGATCTAGCAGCAGG - Intergenic
997943272 5:138177656-138177678 GCAGCTTGTGTTCTGGGAAAGGG + Exonic
998181275 5:139945986-139946008 GCATCATATGTTCATGAATCAGG + Intronic
998678498 5:144437247-144437269 GCAGCTTGGGTACTTAACTCAGG - Intronic
1000816469 5:165928827-165928849 GCATGTTGTGTTCTTGATTCTGG + Intergenic
1002385530 5:178863022-178863044 GGACCTTGTGTTCTTGTCTCAGG + Intronic
1005553381 6:26947674-26947696 GTAGCCTATGTTCTTGAATGCGG - Intergenic
1006878124 6:37316158-37316180 GCAGCTGGTTTTGTTGAATATGG + Intronic
1012358786 6:98350500-98350522 ACAGCCTGTGTTCTAGACTCAGG - Intergenic
1015146026 6:129988169-129988191 TGAGCTTGTGTTTTAGAATCTGG - Intergenic
1015233602 6:130944883-130944905 GCTCCTTGTGTTCTTCAAGCTGG + Intronic
1019155933 6:170038934-170038956 GCATCTGGTGTGCATGAATCAGG + Intergenic
1020444481 7:8255029-8255051 GCAGGTTGTGGTCATGATTCTGG - Intronic
1023488484 7:40712363-40712385 GCATATTGTGTTGTTGCATCAGG + Intronic
1023573317 7:41595453-41595475 GTAGCCTGTGTTCTTGACTGTGG - Intergenic
1033295390 7:140129106-140129128 GCAGCTGGTGTACTGGGATCTGG + Intronic
1035226048 7:157432739-157432761 GCAGCTTGTGTGCCGGAAGCTGG + Intergenic
1035372265 7:158387062-158387084 GCAGCATGTGTTCTAGAACACGG + Intronic
1036145440 8:6250713-6250735 GAAGCTTGCGTTCATGCATCTGG - Intergenic
1037170654 8:15887502-15887524 GCATCTTCTGTTCTTGAACTGGG - Intergenic
1040552418 8:48448390-48448412 GCAACATGTGATCTTGAGTCAGG - Intergenic
1041413146 8:57578558-57578580 GAAGCTTCTGTACTTGACTCAGG - Intergenic
1042363409 8:67908285-67908307 GCATCTTCTGTTCTTCAACCTGG - Intergenic
1043942065 8:86207134-86207156 GCATTCTGTGTTCTTGAACCTGG - Intergenic
1047789821 8:128191547-128191569 CAATCTTGGGTTCTTGAATCTGG - Intergenic
1047872619 8:129101692-129101714 GCAGCTTTTGTTTTTGGAGCTGG - Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049987635 9:966913-966935 TCAGCTTGTGTTCATCAATAGGG - Intronic
1050152216 9:2628301-2628323 TCAGATTGTATTCTTGAATGAGG - Intronic
1050743649 9:8851614-8851636 GGAACTAGTGTTCTTGAATATGG + Intronic
1052248438 9:26367612-26367634 GTTGCTTTTGTTCTTGACTCTGG - Intergenic
1055831677 9:80386464-80386486 GCAGCTTGTGGCATTGAATAGGG + Intergenic
1056605044 9:88078539-88078561 GGAGCTTGTCTTCTTGCCTCAGG + Intergenic
1056840047 9:89991431-89991453 GCAACTGGTGTTGTTGAATTTGG + Intergenic
1060994849 9:127870088-127870110 GCAGCTGGTCTTCTTGGCTCTGG - Intronic
1061299102 9:129694594-129694616 GAAGCTTGGGTGCTGGAATCTGG + Intronic
1062033586 9:134372867-134372889 GCTGCTTGAGATCTGGAATCTGG + Intronic
1187743638 X:22384509-22384531 GCAGATTGTGTCCGTGACTCCGG + Intergenic
1200377754 X:155802205-155802227 ACAGTTTGTTTGCTTGAATCAGG + Intergenic