ID: 1165283481

View in Genome Browser
Species Human (GRCh38)
Location 19:34817400-34817422
Sequence CACAAACACCCCAGGGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165283481_1165283485 -10 Left 1165283481 19:34817400-34817422 CCCAAGACCCTGGGGTGTTTGTG 0: 1
1: 0
2: 2
3: 17
4: 206
Right 1165283485 19:34817413-34817435 GGTGTTTGTGAATGTGTCCAAGG 0: 1
1: 0
2: 2
3: 26
4: 316
1165283481_1165283487 -3 Left 1165283481 19:34817400-34817422 CCCAAGACCCTGGGGTGTTTGTG 0: 1
1: 0
2: 2
3: 17
4: 206
Right 1165283487 19:34817420-34817442 GTGAATGTGTCCAAGGACTTGGG 0: 1
1: 0
2: 2
3: 25
4: 221
1165283481_1165283486 -4 Left 1165283481 19:34817400-34817422 CCCAAGACCCTGGGGTGTTTGTG 0: 1
1: 0
2: 2
3: 17
4: 206
Right 1165283486 19:34817419-34817441 TGTGAATGTGTCCAAGGACTTGG 0: 1
1: 0
2: 2
3: 20
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165283481 Original CRISPR CACAAACACCCCAGGGTCTT GGG (reversed) Intergenic
900203850 1:1422750-1422772 CAGAATCACTCCAGGTTCTTTGG - Intergenic
902067636 1:13700844-13700866 CACATACACCCGTGGGTCTATGG - Intronic
904411985 1:30330160-30330182 CACACTGACCCCAGGCTCTTGGG - Intergenic
905244844 1:36605622-36605644 CACACACACCCCAGAGCCTTAGG + Intergenic
905370351 1:37479703-37479725 CACACACACCTCAGGGACTGGGG - Intronic
905592316 1:39174960-39174982 AACAAACAGCCCAGAGACTTAGG - Intronic
910027605 1:82676534-82676556 CAAAAACAGGCCAGGCTCTTTGG + Intergenic
910340074 1:86176385-86176407 CACACACACACCAGGTTCATAGG - Intergenic
911291423 1:96060759-96060781 CAGAAACACACCTGGGTCTCTGG + Intergenic
915091205 1:153427648-153427670 CAAAAACTCTCCAGGGTTTTAGG + Intergenic
915093908 1:153445643-153445665 CAAAAACTCTCCAGGGTTTTAGG - Intergenic
918538448 1:185601724-185601746 CAAAAGCTCCCCAGGTTCTTGGG + Intergenic
918639843 1:186826600-186826622 CTCAAAAACCCCAGGGGGTTGGG - Intergenic
920070761 1:203301439-203301461 CACTCCCACCCAAGGGTCTTGGG - Intergenic
920242395 1:204562589-204562611 CACTGCCACCCCAGGGTCGTGGG + Intergenic
921939346 1:220824234-220824256 CCCAAACATTCCAGGGTGTTAGG - Intergenic
922510127 1:226158773-226158795 CAGAACCAGCCCATGGTCTTAGG + Intronic
923045575 1:230353432-230353454 CACACACACCCCAGCTGCTTTGG + Intronic
924626087 1:245697673-245697695 GACAAGCACCCCAGGATCTGAGG - Intronic
1063217530 10:3938032-3938054 CACAAACCCCCCAGGGCCACAGG + Intergenic
1066301912 10:34104827-34104849 CCAAAACACCCCACGTTCTTTGG + Intergenic
1066598472 10:37077935-37077957 CCCAACCACCCCAGGTTCTTAGG + Intergenic
1068844646 10:61658496-61658518 CAAACACACCCCAGCGTCTATGG + Intergenic
1070599612 10:77856635-77856657 CCCAAACACCCCTGGCTCCTGGG - Intronic
1070716385 10:78725205-78725227 CACAAACACCCCTGGGGATGGGG + Intergenic
1070909032 10:80101193-80101215 CACAAACTCCGCAGGGGCATGGG + Intergenic
1071790694 10:88951204-88951226 GACAGATACCCCAGGCTCTTAGG - Intronic
1071819435 10:89264908-89264930 CACAAACAGCCCAGGGGCCGTGG - Intronic
1071834815 10:89408531-89408553 CACAAAAACCCCAGGGCTATTGG + Intronic
1072204468 10:93190337-93190359 CACCAACACCACATGGTCTCAGG + Intergenic
1072498281 10:95985577-95985599 CACAATCATCACAGGGTCCTAGG - Intronic
1075193061 10:120329163-120329185 CCCAAACACTCCCTGGTCTTTGG + Intergenic
1077050763 11:565738-565760 CACAAAGACCCCATGATCTAGGG - Intergenic
1077359991 11:2136595-2136617 CAAAAACTCCCCTGGGTCTGCGG - Intronic
1078420794 11:11210615-11210637 CAACAACACCCCAGGTTATTTGG + Intergenic
1081422788 11:42891263-42891285 CACACACACACCAGAGTGTTGGG + Intergenic
1083679249 11:64343704-64343726 CATACACACCCCAGAGGCTTGGG - Intronic
1084458281 11:69281631-69281653 CAGAAACACACCAGGGACCTGGG - Intergenic
1084577187 11:69996941-69996963 CACAAAGATCCCAGGGTGTGGGG + Intergenic
1088796305 11:113269255-113269277 TGCAATCCCCCCAGGGTCTTTGG - Intronic
1088895268 11:114073705-114073727 CAGTAACACCCCAGTGTCTCAGG - Intronic
1089387524 11:118078079-118078101 CACAAACACCCTAGATTGTTTGG - Intronic
1090043146 11:123308306-123308328 CACAGGGACCCCAAGGTCTTGGG + Intergenic
1091042668 11:132296650-132296672 CACACACACACCTGGGTCTTGGG - Intronic
1092890387 12:12964324-12964346 CTCAAACACACCATGCTCTTTGG - Intergenic
1093652147 12:21657865-21657887 CACAACCACCGCAGCCTCTTAGG + Intronic
1097743372 12:63271536-63271558 GCCAAGCACTCCAGGGTCTTTGG + Intergenic
1100393535 12:94164722-94164744 CACACACACCTCAGGAGCTTTGG + Intronic
1105542586 13:21327809-21327831 CACTGACACCCCAGGCTCCTGGG - Intergenic
1106288140 13:28336086-28336108 CCCAAACATGCAAGGGTCTTAGG - Intronic
1107780515 13:43897103-43897125 CAGAAACACTCCAGGGTTTCTGG - Intergenic
1108125134 13:47234321-47234343 CACAGAATCCCCAGGGTCTGGGG + Intergenic
1108494760 13:51014138-51014160 CCCAAACACCTCAGGGACTCGGG + Intergenic
1111047451 13:82833149-82833171 CACAAACAATCCAGAGTATTTGG + Intergenic
1112167148 13:96931748-96931770 CACAAACCCCTCAGGGGGTTTGG + Intergenic
1114186501 14:20406392-20406414 CACTACTACCCCAGGGTCGTTGG - Exonic
1115961334 14:38838023-38838045 CACACGCACCCCAGGGTCCATGG - Intergenic
1117047620 14:51828824-51828846 CAGGAACACCCCAGGGGCTCAGG + Intronic
1117098304 14:52319424-52319446 CCCAAACACCACATGGTTTTTGG - Intronic
1118315938 14:64726188-64726210 AACCAACACCCCTGGGTCTCCGG - Intronic
1118846571 14:69551860-69551882 CTCACACAGCCCAGGGTCTCAGG + Intergenic
1119514557 14:75237785-75237807 CACACACACCCCCGGGTCTCTGG + Intergenic
1119711964 14:76828905-76828927 CAGAAACACTCCAGGGGCCTGGG - Intronic
1122048386 14:99039282-99039304 TACCCACCCCCCAGGGTCTTAGG + Intergenic
1122437007 14:101707124-101707146 CACACACACAGCAGGGTCTGTGG + Intergenic
1126704584 15:51395581-51395603 CAAAAACAGCCCAGGGGCCTTGG + Intronic
1127608090 15:60610228-60610250 CACACACAGTCCAGGGTCTGTGG + Intronic
1127788951 15:62381183-62381205 CACCAACACCCCAGTGGCTGGGG + Intergenic
1128299735 15:66558651-66558673 CACAAAAACCACAGATTCTTGGG - Intronic
1130057080 15:80535872-80535894 AACAAACACCACAGGGACATGGG - Intronic
1130899979 15:88199814-88199836 CTCAAAGATCCCAGGGGCTTGGG + Intronic
1131742019 15:95403159-95403181 CAGCAGCTCCCCAGGGTCTTAGG + Intergenic
1133148259 16:3806881-3806903 CACAGAGACCCCAGGGTATTGGG - Intronic
1134395287 16:13856753-13856775 CACAGAGAGCCCAGGATCTTGGG + Intergenic
1134787959 16:16962098-16962120 CATAAGCACCCCTGGTTCTTGGG - Intergenic
1138492885 16:57386789-57386811 CACAAACACTCCAGGATCCCTGG - Intergenic
1141051688 16:80771294-80771316 CAAAAATAGCCCAGGGTCTAGGG + Intronic
1141304789 16:82852027-82852049 AACCAACACCCCAGTGTCTCTGG - Intronic
1142139675 16:88467301-88467323 CACACACATCCCAGAGTCTCAGG + Intronic
1146968859 17:37056001-37056023 CAATAACATGCCAGGGTCTTGGG - Intronic
1150292372 17:63989039-63989061 CACAAACAGCCCAAGGGCTAAGG - Intergenic
1151506735 17:74532813-74532835 CCCCAACACCCCTGGGTCATTGG + Intergenic
1152539667 17:80968628-80968650 CACGAACACTCAGGGGTCTTGGG + Intergenic
1152751425 17:82064205-82064227 AACAAACACCTCCGGGTCATTGG + Exonic
1153215701 18:2818934-2818956 GACAAACACCCCATATTCTTAGG + Intergenic
1154028836 18:10732311-10732333 CACAAACACACCTGGGTCTCAGG + Intronic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1157107278 18:44786302-44786324 CACACACACCCCAGGCTTTTTGG + Intronic
1157592537 18:48844258-48844280 CAAACCCACCCCAGGGTCCTGGG + Intronic
1158943531 18:62428144-62428166 CTCATACATCCCAGAGTCTTAGG + Intergenic
1162992389 19:14312080-14312102 CACCAACACGCCAGGCTCCTTGG - Intergenic
1163287935 19:16360437-16360459 CAGAAACAGGTCAGGGTCTTGGG + Intronic
1165283481 19:34817400-34817422 CACAAACACCCCAGGGTCTTGGG - Intergenic
1165603340 19:37078000-37078022 CACACACACCCCAAGGGCCTGGG + Intronic
1166382496 19:42362292-42362314 CCCACCCACCCCAGGGTCTCAGG + Intronic
926195378 2:10760699-10760721 CACATGCACCCCATGGTCTTTGG + Intronic
928657852 2:33471926-33471948 CAAAAAGACCCCACGCTCTTGGG - Intronic
929624723 2:43394918-43394940 CACAACAACCCCAGGGTTCTAGG + Intronic
930246702 2:48991056-48991078 CATACATACCCTAGGGTCTTAGG - Intronic
930977851 2:57486267-57486289 CAGAAAGACACCAGGGCCTTAGG + Intergenic
931654357 2:64497502-64497524 GTCAAACACTCCAGGGTCTTGGG - Intergenic
935754330 2:106265301-106265323 AAATGACACCCCAGGGTCTTGGG - Intergenic
936114047 2:109688061-109688083 AAATGACACCCCAGGGTCTTGGG + Intergenic
937706340 2:124924985-124925007 CACACACAACCAAGGGTCCTGGG - Intergenic
940269986 2:151880144-151880166 CACAGACACTTCAGGGCCTTGGG - Intronic
942182423 2:173392963-173392985 CACAAAAACCCTAGGGGCTGGGG - Intergenic
942471682 2:176267581-176267603 CATAAACACAGCAGCGTCTTAGG - Intergenic
943202781 2:184850274-184850296 AACAAACACATCAGGGTCATTGG - Intronic
945538190 2:211047073-211047095 CACACACACCCCAGGAGATTTGG + Intergenic
947088086 2:226478207-226478229 TTCAAACAGCGCAGGGTCTTTGG - Intergenic
948394347 2:237633306-237633328 CACAAACAGCCCAAGGTCACAGG - Intronic
948666181 2:239536150-239536172 CACCAACTCCCCAGGGCCTAAGG - Intergenic
949031474 2:241799323-241799345 CACAAACCCACCTGGGCCTTTGG + Intronic
1168804047 20:662485-662507 CACACACACCCCCGCGTCTCGGG - Exonic
1169304711 20:4479178-4479200 CTCAACCATCCCTGGGTCTTAGG + Intergenic
1169476300 20:5934037-5934059 CACTAACTCCCTAGGGTGTTTGG - Intergenic
1169989454 20:11484761-11484783 AACAAACACCTCAGGTTCTAAGG - Intergenic
1172409774 20:34712229-34712251 CACAGCCAGCCTAGGGTCTTCGG + Exonic
1172734100 20:37112927-37112949 CACAAAAACCCTAGGGTTCTGGG + Intronic
1172977800 20:38919729-38919751 CACAAAGACCCCAGGGTGCTGGG - Exonic
1174163869 20:48570989-48571011 CACAAACACACATGGGTTTTGGG + Intergenic
1174506326 20:51020029-51020051 CACAATCTCCCCAGGAACTTGGG - Intronic
1175378181 20:58543645-58543667 CACAAACCCCCAAGAGCCTTAGG - Intergenic
1177772738 21:25534661-25534683 CAGAAACCCCCCAGTTTCTTAGG + Intergenic
1180009725 21:45041366-45041388 CACCAACCCCCCAGGGTTTCTGG + Intergenic
1180762900 22:18222849-18222871 AAGAAACCCCCCAGTGTCTTTGG + Intergenic
1180772745 22:18401698-18401720 AAGAAACCCCCCAGTGTCTTTGG - Intergenic
1180804125 22:18651314-18651336 AAGAAACCCCCCAGTGTCTTTGG - Intergenic
1180806650 22:18718163-18718185 AAGAAACCCCCCAGTGTCTTTGG + Intergenic
1180848202 22:18995739-18995761 CAGAAACTCCCCAGGGACCTGGG + Intergenic
1181217595 22:21343945-21343967 AAGAAACCCCCCAGTGTCTTTGG + Intergenic
1181500805 22:23314589-23314611 CACAACCTCGCCACGGTCTTTGG + Exonic
1182693044 22:32176686-32176708 CACAAGGAACCCAAGGTCTTAGG - Intergenic
1182721531 22:32405043-32405065 CACCCCCACCCCAGGGTCTCTGG - Intronic
1184327172 22:43797759-43797781 CACAAAGACACCAAGGACTTTGG - Intronic
1185223644 22:49641223-49641245 CACAGACACCCCAGGGACAAGGG + Intronic
1203234581 22_KI270731v1_random:142686-142708 AAGAAACCCCCCAGTGTCTTTGG - Intergenic
951812134 3:26712393-26712415 TACACACACCCCAGGGCCATGGG + Intergenic
953715746 3:45315684-45315706 CACAAACACCCTGCTGTCTTGGG - Intergenic
955092583 3:55767359-55767381 CTCAAAGACCCCAGAGGCTTCGG + Intronic
955101203 3:55851845-55851867 CAGAGAGAGCCCAGGGTCTTGGG + Intronic
955851332 3:63223281-63223303 TCCAAAAACCTCAGGGTCTTTGG - Intergenic
960128823 3:114030879-114030901 AACACCCACCCCAGGGCCTTAGG - Intronic
960878210 3:122317765-122317787 ACCAAACACTCCAGGGGCTTTGG + Intergenic
961457983 3:127033633-127033655 CACAGAAACCCCAGGGTGTGAGG + Intronic
962254635 3:133861926-133861948 GACAAGATCCCCAGGGTCTTTGG - Intronic
962555126 3:136541575-136541597 CACACACACACCAGGGGTTTGGG + Intronic
964077596 3:152710554-152710576 CACAAACAGCACAATGTCTTTGG + Intergenic
965875722 3:173316866-173316888 CACAAACATCACAGGGTTTCAGG + Intergenic
966344364 3:178962022-178962044 AACAAACACCCGAGGGTGTGGGG + Intergenic
968481425 4:834770-834792 CACAGAGAGACCAGGGTCTTGGG + Intergenic
968818387 4:2833280-2833302 GACAAGCAACCCAGGGTCTATGG - Intronic
970122713 4:12774862-12774884 CACAAGCATCCAAGGATCTTGGG - Intergenic
971732738 4:30406798-30406820 CACAAGCACCACTGGGTCTGAGG + Intergenic
972923044 4:43967287-43967309 GACTTACACCCCAGGGTCATGGG + Intergenic
975411921 4:74062837-74062859 CAGTAGCACCCCAGGTTCTTAGG - Intergenic
976455611 4:85243907-85243929 CACATACATCCCAAGTTCTTTGG + Intergenic
977264907 4:94842077-94842099 CACACACACCCCAGGGTGCTTGG + Intronic
980312358 4:131147888-131147910 GACAAACACAGCAGGGTCATAGG + Intergenic
981111798 4:140943134-140943156 CACCAACATCCCAGGGTCTTTGG + Intronic
982724970 4:158896591-158896613 CACAAAGGCCCCAGTCTCTTAGG - Intronic
984873330 4:184346212-184346234 AACAAAATCCCCAGGGTTTTAGG + Intergenic
989829115 5:45892108-45892130 CACAATCATCACAGGGTCTTGGG + Intergenic
992808239 5:80359867-80359889 ACCAAGCACCCCAGGGGCTTTGG - Intergenic
993629959 5:90274328-90274350 CAAAAACACCACAGGGTTTCTGG + Intergenic
997056699 5:130452302-130452324 CACACACAGCACAGGGTCTCTGG + Intergenic
997865261 5:137456517-137456539 CAAAAACACCCTTGGGTCGTTGG - Intronic
998896127 5:146802096-146802118 CACAAACACCCAATGGTTCTTGG + Intronic
999305370 5:150515967-150515989 CACCCCCACCCCAGGGTATTTGG + Intronic
999482142 5:151958515-151958537 CACAAACACCCTAGGATTTGGGG - Intergenic
1000117905 5:158170647-158170669 AATAAACACCCCAGGGTCACAGG - Intergenic
1001042045 5:168343056-168343078 TACAAACCCCCCAGGCTCTTAGG - Intronic
1003233736 6:4277490-4277512 CACCAGCACTCCAGGTTCTTTGG + Intergenic
1003409424 6:5850007-5850029 CACTGACACCCCAGGCTCCTGGG + Intergenic
1006204155 6:32325368-32325390 CCCAAGCACTCCAGGGGCTTTGG + Intronic
1008170684 6:48202020-48202042 CACAATCATCACAGGGTCCTGGG - Intergenic
1008558701 6:52701816-52701838 CAAAAACACTCCAGTATCTTTGG - Intergenic
1010732617 6:79406691-79406713 AACAAACAAACCAGGTTCTTTGG + Intergenic
1013392031 6:109695214-109695236 CACAAAGAACCGAGGGTCCTGGG + Intronic
1013432456 6:110067027-110067049 CACCTACACCTCAGGCTCTTGGG - Intergenic
1019578137 7:1747325-1747347 CACACACACACGAGGGACTTCGG + Exonic
1019708836 7:2509287-2509309 CACAGCCAGCACAGGGTCTTGGG - Intergenic
1019895271 7:3977500-3977522 CAGAAAGAACCCAGGGTCGTAGG - Intronic
1020000848 7:4754687-4754709 CACAGACAGCCCAGGGCCTGCGG + Intronic
1022329516 7:29364023-29364045 AACAAACAGACCAGGGGCTTTGG + Intronic
1023605328 7:41926184-41926206 CACAAACATGCCAGGATCTGAGG + Intergenic
1023687710 7:42753439-42753461 CACCAGCAGCCCAGGCTCTTGGG - Intergenic
1024083162 7:45872771-45872793 CACTAACACCCTGGGGTCCTCGG - Intergenic
1027246995 7:76374173-76374195 CACAGAAACCCCTGGGTCTTGGG + Intergenic
1029649905 7:101884475-101884497 CCCAAACAGCACAAGGTCTTTGG - Intronic
1030903710 7:115155978-115156000 AATAACCACCCCAGGGTCCTGGG - Intergenic
1035227297 7:157440801-157440823 CAGAAAGACCGCAGGGTCTGAGG + Intergenic
1035480300 7:159176627-159176649 CACACACAGCCCAGGATGTTGGG + Intergenic
1038537627 8:28365195-28365217 CACAAGTAACCAAGGGTCTTTGG + Intronic
1043507468 8:80916449-80916471 CCCAAACTTCCAAGGGTCTTAGG + Intergenic
1052494352 9:29209169-29209191 CACAAACGCACCATGTTCTTAGG + Intergenic
1053441167 9:38117667-38117689 CATACACACCCCCGGGTCATTGG - Intergenic
1056392860 9:86155115-86155137 CACAAAAACCCCAGGGCTATCGG - Intergenic
1056806384 9:89732165-89732187 CAGAAACCCCCCTGGGACTTGGG + Intergenic
1056842133 9:90006737-90006759 CAGAAACACACCAGGGTCTTAGG - Intergenic
1057353646 9:94318999-94319021 CAAAAGCACAGCAGGGTCTTCGG + Exonic
1057654105 9:96938593-96938615 CAAAAGCACAGCAGGGTCTTCGG - Exonic
1057870061 9:98709960-98709982 CACAAGGAACCCAAGGTCTTAGG - Intergenic
1060668300 9:125446674-125446696 CACAAAGACACCAGGGCCTGGGG + Intronic
1061021014 9:128014764-128014786 CACAGGCTCCCCAGGGGCTTTGG + Intergenic
1061902507 9:133680315-133680337 CCCAAACCCCCCAGTGTCTGTGG + Intronic
1061934433 9:133849524-133849546 CACAAACACAGCAGGGACATGGG - Intronic
1062231952 9:135486809-135486831 AAGAAACCCCCCAGTGTCTTTGG + Exonic
1185728273 X:2440641-2440663 CATCAAGACCCCAGGGTCTTTGG + Intronic
1187463885 X:19512151-19512173 CACACACACCCCAGGGCCTGTGG + Intronic
1189685297 X:43557439-43557461 CACAAACTCCCTAGGGGATTTGG + Intergenic
1190450952 X:50580184-50580206 CAAAAATAACCAAGGGTCTTGGG + Intergenic
1192508425 X:71705884-71705906 CAGAGACACCCCAGGAGCTTTGG + Intergenic
1192512219 X:71728830-71728852 CAGAGACACCCCAGGAGCTTTGG - Intergenic
1192514478 X:71752675-71752697 CAGAGACACCCCAGGAGCTTTGG + Intergenic
1192518271 X:71775669-71775691 CAGAGACACCCCAGGAGCTTTGG - Intergenic
1192803766 X:74492587-74492609 CAGAAACACCCCAGGGACCACGG + Intronic
1195564523 X:106325365-106325387 CACAAAAAGCACAGGGCCTTTGG + Intergenic
1196419465 X:115507466-115507488 CACAAAAACCCCAGGGCTATTGG - Intergenic
1199719137 X:150529618-150529640 CTGAAACACCCCAGTGTCTGTGG + Intergenic
1200280800 X:154775417-154775439 AACAAGCACCCCAGGGTATGAGG - Intronic
1200312251 X:155089568-155089590 CACACTCACCTTAGGGTCTTTGG - Intronic
1201603324 Y:15756197-15756219 CACAAACAACCAAGGGTCTCAGG + Intergenic
1202247489 Y:22834645-22834667 CACAATCATCACAGGGTCCTGGG + Intergenic
1202400477 Y:24468393-24468415 CACAATCATCACAGGGTCCTGGG + Intergenic
1202470303 Y:25201693-25201715 CACAATCATCACAGGGTCCTGGG - Intergenic