ID: 1165284209

View in Genome Browser
Species Human (GRCh38)
Location 19:34825781-34825803
Sequence TAAATGTGAAATCCGCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165284208_1165284209 2 Left 1165284208 19:34825756-34825778 CCACATGATGAAGACATCAAAAC 0: 1
1: 0
2: 1
3: 16
4: 191
Right 1165284209 19:34825781-34825803 TAAATGTGAAATCCGCTTCAAGG 0: 1
1: 0
2: 1
3: 3
4: 105
1165284207_1165284209 10 Left 1165284207 19:34825748-34825770 CCTTAAGACCACATGATGAAGAC 0: 1
1: 0
2: 2
3: 14
4: 134
Right 1165284209 19:34825781-34825803 TAAATGTGAAATCCGCTTCAAGG 0: 1
1: 0
2: 1
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165284209 Original CRISPR TAAATGTGAAATCCGCTTCA AGG Intergenic
903940100 1:26923897-26923919 GATATGAGAAATCTGCTTCATGG + Intronic
908749675 1:67408726-67408748 TAAATGTGAAATACTAATCATGG + Intronic
909718287 1:78736596-78736618 ACAATGTGAAATCTCCTTCAGGG - Intergenic
916043891 1:160983583-160983605 TAAATGTTATAACCGATTCAAGG - Intergenic
918187171 1:182138188-182138210 TCAAGGTGAATTCCTCTTCATGG + Intergenic
918659026 1:187066291-187066313 TAAAAGTGAAATACGCAACAGGG + Intergenic
918849280 1:189664622-189664644 TAAATGTGAATTCTGCCTTAGGG + Intergenic
921558478 1:216627780-216627802 TAATTGTGAAATATGCTCCAGGG + Intronic
1069765562 10:70855174-70855196 AAAATGTGAAATCTGCATAAAGG + Intronic
1072265804 10:93726692-93726714 TAAATGTGAATTGCATTTCAAGG + Intergenic
1074692089 10:116015512-116015534 TAAATGGGACAACCGCATCAAGG + Intergenic
1077741612 11:4852338-4852360 TAAATGTCATTTCCGATTCATGG - Intronic
1078833481 11:15000518-15000540 TAAATGTGATGTCAACTTCAGGG + Intronic
1087279113 11:96190704-96190726 TAAATGTAAATCCCTCTTCATGG + Intronic
1087361794 11:97169958-97169980 TAAATGGGAAATCAGGCTCATGG - Intergenic
1089021402 11:115219009-115219031 TAAATGAGAAAACCGATTTAGGG - Intronic
1095045202 12:37495290-37495312 TAAATGTGGAGTTCACTTCAAGG + Intergenic
1095909991 12:47416513-47416535 TAAATGTGAACTGCTCTTCCAGG - Intergenic
1096011493 12:48220415-48220437 TTAATGTTAAATCAACTTCAAGG + Intergenic
1098230523 12:68368306-68368328 GAAATTTGAATTCTGCTTCATGG - Intergenic
1098757628 12:74386709-74386731 TAAATGAGCCACCCGCTTCATGG - Intergenic
1099436145 12:82647901-82647923 AAAATGTGAAATCTTTTTCAAGG + Intergenic
1099785767 12:87261506-87261528 TGAATGTGAAGTCCTCATCAAGG + Intergenic
1105730740 13:23212896-23212918 AGAATGTGAAATCCGAGTCAAGG - Intronic
1111865204 13:93759568-93759590 TAAATCTGAAATCCGATGTAAGG - Intronic
1111893333 13:94110230-94110252 TAAATGTGAAATCATTGTCAAGG + Intronic
1111928672 13:94490933-94490955 TCAAGGTGAAATCCATTTCATGG - Intergenic
1112926497 13:104681652-104681674 TAAATGTGTAATTATCTTCATGG - Intergenic
1124967324 15:34445093-34445115 AAAATGTGAAATCATCTTCTCGG + Intergenic
1125254882 15:37752171-37752193 AAAATGTGAAATCCTCTACAAGG - Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1126289944 15:47063214-47063236 TAAATGTGGAGTTCACTTCAAGG - Intergenic
1126397788 15:48237523-48237545 TACATGTGAACTCAGCATCAGGG - Intronic
1128331438 15:66758014-66758036 TAAATGTGGAATTCGCTTGAAGG - Intronic
1133987427 16:10679129-10679151 TAAATGTGAAGTCCTTGTCATGG + Intronic
1135514226 16:23116309-23116331 TAAAAGTGAAATCTGGTTTATGG + Intronic
1140245224 16:73242262-73242284 TAATTGTGAACTGGGCTTCAGGG - Intergenic
1143130044 17:4672350-4672372 TAACTGTCAAATCCTCTTCCAGG + Exonic
1149588911 17:57813049-57813071 TAAATGTGAAAATGGCTCCAAGG + Intergenic
1152561129 17:81079296-81079318 TAAGAGTGAAACCCGCTCCACGG - Intronic
1153852456 18:9108606-9108628 TAATTGTGAAATCTATTTCAAGG - Intronic
1156252966 18:35369620-35369642 CAAATGTGAAATCTGCTTCAAGG - Exonic
1165284209 19:34825781-34825803 TAAATGTGAAATCCGCTTCAAGG + Intergenic
930421773 2:51162878-51162900 TAACTGTGAAGTCAGCATCAGGG - Intergenic
932652806 2:73578083-73578105 TAATTGTTATATCCTCTTCATGG + Intronic
933936259 2:87205997-87206019 TAAGTGTAAGCTCCGCTTCAAGG - Intergenic
935421428 2:102873281-102873303 TAGAAATGAAATCCGCTTGATGG - Intergenic
936356890 2:111759832-111759854 TAAGTGTAAGCTCCGCTTCAAGG + Intergenic
936953796 2:118004289-118004311 TAAATGTAAAATCCCATTTATGG + Intronic
941516266 2:166483216-166483238 CAAATTTGAAATTCGTTTCAAGG - Intronic
941593737 2:167451118-167451140 GAAAGGTGAAGTCCACTTCAAGG - Intergenic
943175984 2:184475019-184475041 CAAATGTGTAAACTGCTTCAGGG + Intergenic
945113008 2:206381673-206381695 TAAAAGTGAATACAGCTTCAGGG + Intergenic
1169668831 20:8071716-8071738 TAAGTCTGAAATCCACTTTATGG + Intergenic
1171539746 20:25938880-25938902 TAAATGTGGAGTTCACTTCAAGG + Intergenic
1171801300 20:29621385-29621407 TAAATGTGGAGTTCACTTCAAGG - Intergenic
1171842672 20:30234107-30234129 TAAATGTGGAGTTCACTTCAAGG + Intergenic
1174199381 20:48796582-48796604 TAAATGTGTAATCATTTTCATGG - Intronic
1174364195 20:50046614-50046636 AAAATGTGAAAGCTTCTTCAGGG + Intergenic
1174551313 20:51363644-51363666 TAAATGTGAAACCACATTCAGGG + Intergenic
1175213548 20:57376982-57377004 TAAAAGAGAAATTTGCTTCAGGG + Intronic
1176790911 21:13318195-13318217 TAAATCTGAAATCAGTATCAGGG - Intergenic
1176940100 21:14913050-14913072 TAAATGTCACATCCGTTGCACGG + Intergenic
1178264788 21:31132853-31132875 TGAATGTCAAATACCCTTCAAGG + Intronic
1182070137 22:27457788-27457810 TCCATGTGACATCAGCTTCAGGG - Intergenic
951375305 3:21907597-21907619 TAAATGTGGAATCCGTTAAAAGG + Intronic
956516817 3:70058875-70058897 CAAATCTGAATTCCACTTCATGG - Intergenic
962991960 3:140585909-140585931 TAAAAGTGAAACCCACTGCATGG + Intergenic
963083179 3:141413358-141413380 TAAAGCTGAAATCTGCTTCCTGG + Intronic
963374261 3:144443602-144443624 GAGATGTGAAATGAGCTTCATGG - Intergenic
964409517 3:156383329-156383351 TGAATGGGTAATCTGCTTCAGGG + Intronic
977144656 4:93423047-93423069 TTTATATGAAATCAGCTTCAAGG - Intronic
977311986 4:95399493-95399515 TAAATGTAAAATCCTCATGATGG + Intronic
979521759 4:121675615-121675637 TACATGTGAAAACTGCTTTATGG - Intronic
980066622 4:128196174-128196196 TCACTGTGACATCCGCTTCCCGG - Intronic
980381092 4:132018683-132018705 TAAATGAGAATTCCACTTCCAGG + Intergenic
990547119 5:56834059-56834081 TAAAACTGAAATCTCCTTCAAGG + Intronic
993448939 5:88049892-88049914 TACATGTCAAATCCACTTCAGGG - Intergenic
994176863 5:96720508-96720530 GAAATATGAAAGCTGCTTCATGG - Intronic
994447163 5:99891024-99891046 TAAACGTGAATTCCACTACAGGG - Intergenic
994510311 5:100694763-100694785 GAAATGTGAAGACCTCTTCAAGG + Intergenic
996141212 5:119912310-119912332 TAAATGTAAAATACGCTAGAAGG - Intergenic
997176137 5:131779835-131779857 TAAATGTGAAATCTGGGTAATGG + Intronic
1006557901 6:34884696-34884718 TAAATTTGAATTCCTCTTTAGGG - Intronic
1007014030 6:38444774-38444796 TAAATGTTAAAACAGCTTTATGG + Intronic
1009350002 6:62662409-62662431 TAAAAGTGAATTTCGCTTTATGG - Intergenic
1009667996 6:66707522-66707544 TAAATGTGACATCTGGTTCCAGG + Intergenic
1010671218 6:78688991-78689013 TAAATGTAAACTCCAATTCAAGG - Intergenic
1013355398 6:109341803-109341825 TAAGTGAGAAATCTGCTTTAAGG + Intergenic
1014460685 6:121691555-121691577 TAAATTTGAAATCATCTTCCTGG - Intergenic
1024306137 7:47931121-47931143 AAAATGTGAAATCGGCCACAGGG + Exonic
1025291132 7:57724818-57724840 TAAATGTGGAGTTCACTTCAAGG + Intergenic
1027496897 7:78899106-78899128 TAAATGTGAAATCTTCTTGTTGG - Intronic
1034302999 7:150032496-150032518 TACATGTGAAATCTCATTCAGGG - Intergenic
1034803048 7:154064772-154064794 TACATGTGAAATCTCATTCAGGG + Intronic
1035812623 8:2505191-2505213 TCCATGTGAAATCACCTTCATGG - Intergenic
1037738544 8:21586337-21586359 TAAATGTGAAGTCCTCTTATTGG + Intergenic
1041630873 8:60085463-60085485 GAAATTTGAATTCCTCTTCAGGG + Intergenic
1045763063 8:105633362-105633384 TAAAAGTGAATGCCGGTTCACGG + Intronic
1045866993 8:106878742-106878764 TAAATATGAATTCTGATTCAGGG + Intergenic
1047435609 8:124833427-124833449 TATATGTGAAAACAGCTCCACGG - Intergenic
1049998724 9:1053390-1053412 AAAAAGTGAAATCCCTTTCAGGG - Intronic
1052084426 9:24247236-24247258 CAGATGTGAAATTCTCTTCAAGG - Intergenic
1056285829 9:85087310-85087332 TAAAAGTTAAATCATCTTCAGGG - Intergenic
1185678643 X:1869818-1869840 TAAATCTAAAATCAGATTCATGG + Intergenic
1188927027 X:36056335-36056357 TAAATATGAAATGCCCTTCTTGG - Intronic
1193183559 X:78486307-78486329 TATCTGTGAAATCCTTTTCAAGG - Intergenic
1193629484 X:83864738-83864760 TAAATGTGAAAGCCATTCCATGG - Intronic
1197778252 X:130134813-130134835 AAACTGTGAAATTCGCTTAATGG + Intronic
1197820306 X:130534998-130535020 TAAATGGGAAAACCCCTGCATGG + Intergenic