ID: 1165285310

View in Genome Browser
Species Human (GRCh38)
Location 19:34837393-34837415
Sequence TCACTGCTGCTTACAGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165285305_1165285310 -5 Left 1165285305 19:34837375-34837397 CCAGCTTGGTGCCAGAGCTCACT No data
Right 1165285310 19:34837393-34837415 TCACTGCTGCTTACAGGCTGGGG No data
1165285302_1165285310 19 Left 1165285302 19:34837351-34837373 CCAGTACAACTTGCAGAGAGGGG No data
Right 1165285310 19:34837393-34837415 TCACTGCTGCTTACAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165285310 Original CRISPR TCACTGCTGCTTACAGGCTG GGG Intergenic
No off target data available for this crispr