ID: 1165285588

View in Genome Browser
Species Human (GRCh38)
Location 19:34839109-34839131
Sequence CCCTGCTGGGGCTGGGCCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165285588_1165285596 -7 Left 1165285588 19:34839109-34839131 CCAACGGCCCAGCCCCAGCAGGG No data
Right 1165285596 19:34839125-34839147 AGCAGGGGACTCTCGAGCTTCGG No data
1165285588_1165285597 -6 Left 1165285588 19:34839109-34839131 CCAACGGCCCAGCCCCAGCAGGG No data
Right 1165285597 19:34839126-34839148 GCAGGGGACTCTCGAGCTTCGGG No data
1165285588_1165285599 15 Left 1165285588 19:34839109-34839131 CCAACGGCCCAGCCCCAGCAGGG No data
Right 1165285599 19:34839147-34839169 GGATTCCGCCTACCCGGTAGCGG No data
1165285588_1165285598 9 Left 1165285588 19:34839109-34839131 CCAACGGCCCAGCCCCAGCAGGG No data
Right 1165285598 19:34839141-34839163 GCTTCGGGATTCCGCCTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165285588 Original CRISPR CCCTGCTGGGGCTGGGCCGT TGG (reversed) Intergenic
No off target data available for this crispr