ID: 1165285591

View in Genome Browser
Species Human (GRCh38)
Location 19:34839116-34839138
Sequence GAGAGTCCCCTGCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165285591_1165285598 2 Left 1165285591 19:34839116-34839138 CCCAGCCCCAGCAGGGGACTCTC No data
Right 1165285598 19:34839141-34839163 GCTTCGGGATTCCGCCTACCCGG No data
1165285591_1165285604 27 Left 1165285591 19:34839116-34839138 CCCAGCCCCAGCAGGGGACTCTC No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1165285591_1165285599 8 Left 1165285591 19:34839116-34839138 CCCAGCCCCAGCAGGGGACTCTC No data
Right 1165285599 19:34839147-34839169 GGATTCCGCCTACCCGGTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165285591 Original CRISPR GAGAGTCCCCTGCTGGGGCT GGG (reversed) Intergenic