ID: 1165285592 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:34839117-34839139 |
| Sequence | CGAGAGTCCCCTGCTGGGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1165285592_1165285604 | 26 | Left | 1165285592 | 19:34839117-34839139 | CCAGCCCCAGCAGGGGACTCTCG | No data | ||
| Right | 1165285604 | 19:34839166-34839188 | GCGGCTGTTTAGACCCAGACCGG | 0: 1 1: 0 2: 0 3: 3 4: 55 |
||||
| 1165285592_1165285599 | 7 | Left | 1165285592 | 19:34839117-34839139 | CCAGCCCCAGCAGGGGACTCTCG | No data | ||
| Right | 1165285599 | 19:34839147-34839169 | GGATTCCGCCTACCCGGTAGCGG | No data | ||||
| 1165285592_1165285598 | 1 | Left | 1165285592 | 19:34839117-34839139 | CCAGCCCCAGCAGGGGACTCTCG | No data | ||
| Right | 1165285598 | 19:34839141-34839163 | GCTTCGGGATTCCGCCTACCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1165285592 | Original CRISPR | CGAGAGTCCCCTGCTGGGGC TGG (reversed) | Intergenic | ||