ID: 1165285595

View in Genome Browser
Species Human (GRCh38)
Location 19:34839123-34839145
Sequence GAAGCTCGAGAGTCCCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165285595_1165285604 20 Left 1165285595 19:34839123-34839145 CCAGCAGGGGACTCTCGAGCTTC No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1165285595_1165285599 1 Left 1165285595 19:34839123-34839145 CCAGCAGGGGACTCTCGAGCTTC No data
Right 1165285599 19:34839147-34839169 GGATTCCGCCTACCCGGTAGCGG No data
1165285595_1165285598 -5 Left 1165285595 19:34839123-34839145 CCAGCAGGGGACTCTCGAGCTTC No data
Right 1165285598 19:34839141-34839163 GCTTCGGGATTCCGCCTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165285595 Original CRISPR GAAGCTCGAGAGTCCCCTGC TGG (reversed) Intergenic