ID: 1165285599

View in Genome Browser
Species Human (GRCh38)
Location 19:34839147-34839169
Sequence GGATTCCGCCTACCCGGTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165285593_1165285599 3 Left 1165285593 19:34839121-34839143 CCCCAGCAGGGGACTCTCGAGCT No data
Right 1165285599 19:34839147-34839169 GGATTCCGCCTACCCGGTAGCGG No data
1165285591_1165285599 8 Left 1165285591 19:34839116-34839138 CCCAGCCCCAGCAGGGGACTCTC No data
Right 1165285599 19:34839147-34839169 GGATTCCGCCTACCCGGTAGCGG No data
1165285595_1165285599 1 Left 1165285595 19:34839123-34839145 CCAGCAGGGGACTCTCGAGCTTC No data
Right 1165285599 19:34839147-34839169 GGATTCCGCCTACCCGGTAGCGG No data
1165285594_1165285599 2 Left 1165285594 19:34839122-34839144 CCCAGCAGGGGACTCTCGAGCTT No data
Right 1165285599 19:34839147-34839169 GGATTCCGCCTACCCGGTAGCGG No data
1165285592_1165285599 7 Left 1165285592 19:34839117-34839139 CCAGCCCCAGCAGGGGACTCTCG No data
Right 1165285599 19:34839147-34839169 GGATTCCGCCTACCCGGTAGCGG No data
1165285588_1165285599 15 Left 1165285588 19:34839109-34839131 CCAACGGCCCAGCCCCAGCAGGG No data
Right 1165285599 19:34839147-34839169 GGATTCCGCCTACCCGGTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165285599 Original CRISPR GGATTCCGCCTACCCGGTAG CGG Intergenic
No off target data available for this crispr