ID: 1165285600

View in Genome Browser
Species Human (GRCh38)
Location 19:34839152-34839174
Sequence AACAGCCGCTACCGGGTAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165285600_1165285611 19 Left 1165285600 19:34839152-34839174 CCGCCTACCCGGTAGCGGCTGTT No data
Right 1165285611 19:34839194-34839216 GCGCGATATGAGCACCGCTCAGG 0: 1
1: 0
2: 0
3: 0
4: 5
1165285600_1165285604 -9 Left 1165285600 19:34839152-34839174 CCGCCTACCCGGTAGCGGCTGTT No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165285600 Original CRISPR AACAGCCGCTACCGGGTAGG CGG (reversed) Intergenic