ID: 1165285604

View in Genome Browser
Species Human (GRCh38)
Location 19:34839166-34839188
Sequence GCGGCTGTTTAGACCCAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165285593_1165285604 22 Left 1165285593 19:34839121-34839143 CCCCAGCAGGGGACTCTCGAGCT No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1165285594_1165285604 21 Left 1165285594 19:34839122-34839144 CCCAGCAGGGGACTCTCGAGCTT No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1165285591_1165285604 27 Left 1165285591 19:34839116-34839138 CCCAGCCCCAGCAGGGGACTCTC No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1165285595_1165285604 20 Left 1165285595 19:34839123-34839145 CCAGCAGGGGACTCTCGAGCTTC No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1165285592_1165285604 26 Left 1165285592 19:34839117-34839139 CCAGCCCCAGCAGGGGACTCTCG No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1165285600_1165285604 -9 Left 1165285600 19:34839152-34839174 CCGCCTACCCGGTAGCGGCTGTT No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165285604 Original CRISPR GCGGCTGTTTAGACCCAGAC CGG Intergenic
900288734 1:1914824-1914846 GTGGGTAATTAGACCCAGACAGG + Exonic
902181182 1:14689749-14689771 GGGGCTGCTTAGACCCTGGCAGG + Intronic
906616416 1:47235637-47235659 GGGGAGGTTGAGACCCAGACTGG + Intergenic
907332785 1:53682169-53682191 GCGGCTGTGTAGAGGCAGAGGGG - Intronic
916247696 1:162705261-162705283 GGGGCTGTTAAGACGCAGTCAGG - Intronic
1075541243 10:123316333-123316355 CCGGGTGTTTAGGCCCAGAATGG + Intergenic
1086690718 11:89786836-89786858 GAGGCTGTTCAGGCCCAGTCAGG + Intergenic
1087039517 11:93784793-93784815 GCGGGTGCTGGGACCCAGACCGG - Intronic
1101858686 12:108465003-108465025 GCTGAGATTTAGACCCAGACAGG + Intergenic
1103333127 12:120168615-120168637 GGGGCTGTTTGGACTCACACTGG + Intronic
1103723975 12:122988899-122988921 GGGGCTGTATAGCCCCAGACAGG + Intronic
1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG + Intergenic
1117296605 14:54386164-54386186 ACGGATGTTAAGACCCAGAGGGG - Intergenic
1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG + Intronic
1128223759 15:65987296-65987318 GTGGCTGTTTAAGCCCAGGCTGG - Intronic
1135534133 16:23279758-23279780 GCAGCTCTTTAAACCCAGCCAGG + Intronic
1140368524 16:74399456-74399478 GCGGCTGTTTATCCTTAGACTGG - Intergenic
1141116445 16:81314022-81314044 GCAGATGTTTAGATTCAGACAGG - Intergenic
1142239485 16:88938689-88938711 GCGGGTGTTCAGACCCAGCATGG - Intronic
1143976245 17:10832013-10832035 GTTGCTGTATAGTCCCAGACTGG - Intronic
1145971882 17:28960970-28960992 GCAGCTGTTAAGACCAGGACAGG + Exonic
1148046499 17:44748174-44748196 GCGGCAGGTTAGACCCAAACAGG + Intronic
1148084829 17:44987815-44987837 GCGGCGGCGGAGACCCAGACAGG - Intergenic
1149679297 17:58493990-58494012 GAGGCAGTTGAGACCCAGATTGG - Intronic
1149789540 17:59465231-59465253 GCAGGTATTTAGAGCCAGACGGG - Intergenic
1151438662 17:74114387-74114409 GCTGCTGTTGAGAGCCAGAAGGG - Intergenic
1154949799 18:21198639-21198661 GCATCTGTTAAGACCCAGAGAGG + Intergenic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1165753864 19:38280092-38280114 GCAGCTGTCTAGACACAGAATGG + Intronic
930311747 2:49750517-49750539 GCGGCTGTTTAGAGGAAGAAGGG - Intergenic
932381400 2:71287133-71287155 GAGGCTGTTAAGACCCAGCTAGG + Intronic
937361267 2:121231637-121231659 GCAGCCATTTGGACCCAGACGGG + Intronic
938729918 2:134139299-134139321 GTGGCTGTTAAGATCCAGAATGG + Intronic
945062399 2:205920618-205920640 GCTGGGGTTTAGACCCAGATAGG - Intergenic
946449290 2:219766051-219766073 GAGGCTGTTTAGAGGAAGACGGG - Intergenic
948830208 2:240594926-240594948 GCTGCTGCTTAGACCCTGCCAGG + Intronic
1170969683 20:21105254-21105276 GGGGTTGTTCAGACCCAGAGCGG - Intergenic
1171869877 20:30516134-30516156 GAGGCTATTTAAACCCAGCCTGG - Intergenic
1179483135 21:41691260-41691282 GCATCTGTTTAGCCCCAGCCAGG - Intergenic
1180054303 21:45349224-45349246 GGGGCTGTGGGGACCCAGACAGG - Intergenic
1181212173 22:21295344-21295366 GCGTGTGTTTAGACACAGATAGG + Intergenic
1184570098 22:45317635-45317657 GTGGCTGTTTAAACCCTGGCGGG - Intronic
954378305 3:50206154-50206176 GCGTTTGTTTACACCCAGGCAGG + Intronic
954623991 3:52012458-52012480 GAGGGTGTGAAGACCCAGACAGG - Intergenic
956183265 3:66537270-66537292 GCAGCAGTTTATACCCAGAGCGG + Intergenic
968738601 4:2314328-2314350 GCTGCTGTTTCAACCCAGACTGG + Intronic
986729563 5:10625160-10625182 GAGGCTGTTTAGGCCCAATCAGG + Intronic
986892711 5:12328525-12328547 GGGCCTGTCTAGACCCACACTGG - Intergenic
999955699 5:156699186-156699208 ATGGCTGTCTAGACACAGACAGG + Intronic
1031998035 7:128245754-128245776 GCTGCTCTTTAGATCCAGGCTGG - Intronic
1034741001 7:153473199-153473221 GCTGCTCTTCAGACTCAGACTGG + Intergenic
1036967029 8:13311191-13311213 GAGGACGTTGAGACCCAGACAGG + Intronic
1037890210 8:22620092-22620114 GGGGCTGCTTAGCCCCAGCCAGG - Exonic
1044492253 8:92833479-92833501 GCTGCTGTGTAGAAACAGACTGG + Intergenic
1052267915 9:26595556-26595578 GAGGCTGTTAAAACCCAGCCTGG - Intergenic
1053467648 9:38321704-38321726 GGGGCAGTTTAGAGCCACACTGG + Intergenic
1054754730 9:68946298-68946320 GGGGCTGTGTAGCCCTAGACTGG - Intronic
1057569316 9:96192063-96192085 ACGGCTGTTGAAACCCACACTGG - Intergenic
1062612728 9:137382284-137382306 GCGCTTGTTTATACACAGACAGG - Intronic