ID: 1165285604

View in Genome Browser
Species Human (GRCh38)
Location 19:34839166-34839188
Sequence GCGGCTGTTTAGACCCAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165285594_1165285604 21 Left 1165285594 19:34839122-34839144 CCCAGCAGGGGACTCTCGAGCTT No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1165285591_1165285604 27 Left 1165285591 19:34839116-34839138 CCCAGCCCCAGCAGGGGACTCTC No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1165285592_1165285604 26 Left 1165285592 19:34839117-34839139 CCAGCCCCAGCAGGGGACTCTCG No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1165285600_1165285604 -9 Left 1165285600 19:34839152-34839174 CCGCCTACCCGGTAGCGGCTGTT No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1165285595_1165285604 20 Left 1165285595 19:34839123-34839145 CCAGCAGGGGACTCTCGAGCTTC No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1165285593_1165285604 22 Left 1165285593 19:34839121-34839143 CCCCAGCAGGGGACTCTCGAGCT No data
Right 1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165285604 Original CRISPR GCGGCTGTTTAGACCCAGAC CGG Intergenic