ID: 1165287541

View in Genome Browser
Species Human (GRCh38)
Location 19:34854181-34854203
Sequence CTGCATCAGAAGATGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165287537_1165287541 0 Left 1165287537 19:34854158-34854180 CCTGTCATGAGAGTGTTCACTGC 0: 1
1: 0
2: 0
3: 8
4: 198
Right 1165287541 19:34854181-34854203 CTGCATCAGAAGATGCAGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 270
1165287535_1165287541 26 Left 1165287535 19:34854132-34854154 CCTTAGGGTACTTAGCACCATGT 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1165287541 19:34854181-34854203 CTGCATCAGAAGATGCAGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 270
1165287536_1165287541 9 Left 1165287536 19:34854149-34854171 CCATGTACACCTGTCATGAGAGT 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1165287541 19:34854181-34854203 CTGCATCAGAAGATGCAGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165287541 Original CRISPR CTGCATCAGAAGATGCAGGG TGG Intergenic
900906831 1:5565126-5565148 CTGCACCAGAAGCTGCATGTGGG + Intergenic
901104859 1:6747228-6747250 CAGCAGCAGGAGATGCAGCGGGG + Intergenic
901327461 1:8376584-8376606 CTGTATCAGAAGCTGGTGGGTGG - Intronic
902236890 1:15063412-15063434 CTGCTTCAGGAGATGGGGGGTGG + Intronic
902331784 1:15734460-15734482 CTGCCTCGCCAGATGCAGGGGGG + Exonic
902742152 1:18446089-18446111 CTGGAACAGAAGGTGCAAGGAGG - Intergenic
903561566 1:24231911-24231933 CTGAATCAGAATGTCCAGGGTGG - Intergenic
906135813 1:43500092-43500114 CTGCATCACAGGCAGCAGGGAGG - Intergenic
910281351 1:85504896-85504918 CTGAATCAGAATTTCCAGGGAGG + Intronic
911635910 1:100236207-100236229 CTTCCTCAGGAGATGGAGGGAGG - Intronic
911814759 1:102333144-102333166 CAGGATAGGAAGATGCAGGGTGG - Intergenic
912866734 1:113264344-113264366 GCTCATGAGAAGATGCAGGGAGG - Intergenic
913079049 1:115364826-115364848 ATGCACCAGAAGGTGCAGTGAGG + Intergenic
914420148 1:147521715-147521737 CTGAATCTGAAGGTGGAGGGAGG + Intergenic
915357333 1:155263180-155263202 CTGCTATAAAAGATGCAGGGGGG + Exonic
915696825 1:157751800-157751822 CTGCATCACAAGATGCAGGTAGG + Intronic
921090590 1:211838426-211838448 CTGATTCAGGAGATCCAGGGTGG - Intergenic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
922728241 1:227936046-227936068 CTGCATAACAAGATGCAGGAAGG - Intronic
923200174 1:231703813-231703835 CTACATCAGAAGTTTCAGGGTGG + Intronic
923251503 1:232182996-232183018 CTTCATCACAAGAGGCTGGGCGG + Intergenic
923456727 1:234171165-234171187 CTGAATCAGAAGCTGGAGTGGGG + Intronic
923640999 1:235760617-235760639 CTGTATCAGTAGATCTAGGGTGG - Intronic
1063818218 10:9801907-9801929 GGACATCAGAAGATGCTGGGTGG - Intergenic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1066189022 10:33038055-33038077 CTGCCACAGAAGTTTCAGGGTGG + Intergenic
1067370540 10:45678300-45678322 CAGCATCATAAGCCGCAGGGTGG + Intergenic
1069784239 10:70977712-70977734 CTGCATCAGAATCTGCAGGTTGG + Intergenic
1070780208 10:79133180-79133202 CTGCATGTGAAAAGGCAGGGAGG - Intronic
1071857946 10:89644977-89644999 CTGAATCGGAAGCCGCAGGGAGG - Exonic
1073072460 10:100803335-100803357 CTGGATCAGAAGGTCCAAGGAGG - Intronic
1073667005 10:105544965-105544987 CTGCAGGAGATGATGCAGGGAGG - Intergenic
1073904491 10:108262115-108262137 GTCTATCAGAAGATGGAGGGTGG - Intergenic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1075566229 10:123506440-123506462 CTGCATGGGAAGATGCAGGAAGG - Intergenic
1075961101 10:126568302-126568324 CAGCAACAGAAAATGCTGGGAGG - Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076939261 10:133590750-133590772 GTGGAGCAGAAGATGCAGGAAGG - Intergenic
1079270758 11:18983571-18983593 CTACATAAGAAGAAGCAAGGAGG + Intergenic
1079873127 11:25824876-25824898 CTGAGTCAGAGGATGCAGAGAGG - Intergenic
1083214186 11:61208191-61208213 CTGCATGAGATGAACCAGGGTGG + Intronic
1083217070 11:61227020-61227042 CTGCATGAGATGAACCAGGGTGG + Intronic
1083219952 11:61245846-61245868 CTGCATGAGATGAACCAGGGTGG + Intronic
1083230387 11:61314049-61314071 CTGCACAAGGAGATGCTGGGTGG - Exonic
1084192566 11:67505464-67505486 CTGCAGCGGAGGAGGCAGGGAGG + Intronic
1084334475 11:68448685-68448707 CAGCTCCAGAAGATGCAGGCCGG - Intronic
1087811710 11:102615671-102615693 CTGCAGCAGAGGGTGCAGGAAGG - Intronic
1088899384 11:114103694-114103716 ATGCTTTAGAAGATGCGGGGTGG + Intronic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1090771002 11:129919871-129919893 TTGCAGCAGAAGAGGCAGGTGGG - Intronic
1091127482 11:133114020-133114042 CTGTTTCTGAAGAAGCAGGGAGG - Intronic
1091703329 12:2678152-2678174 CTGCATTAGAAGTTGCAGAGTGG + Intronic
1092090757 12:5801962-5801984 TTGCGTCAGGAGATGCAGGCAGG + Intronic
1094050127 12:26210664-26210686 CTGTCTCAACAGATGCAGGGGGG - Intronic
1094808034 12:34109527-34109549 CTGTACCAGGAGCTGCAGGGTGG - Intergenic
1100389750 12:94138093-94138115 CTGCAACAGAACAACCAGGGAGG + Intergenic
1104441232 12:128794919-128794941 CTGCCTCAGAAAAGGCAGGAAGG - Intronic
1105484613 13:20814785-20814807 CTCCATCTGGAAATGCAGGGTGG + Intronic
1105597625 13:21854201-21854223 CTGTAACAGAAGATCCAGGCTGG - Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107789014 13:43982042-43982064 CTCCAGCAGAAGAGGCAGGCAGG + Intergenic
1114597256 14:23924214-23924236 CTGCACCAGATGATGCTGGTTGG - Intergenic
1117420517 14:55540312-55540334 CTGGCTCTGAAGATGAAGGGAGG + Intergenic
1117447202 14:55815641-55815663 CTGCACCAGAGGCTGCAGCGTGG + Intergenic
1117874308 14:60236227-60236249 CTACATGAGAAGATGAAGTGAGG - Intergenic
1119678184 14:76572082-76572104 CTTAATAAGAAGATGCAGGCTGG - Intergenic
1121290781 14:92773265-92773287 CTGGATCTGACGATGGAGGGAGG - Intergenic
1121533130 14:94672396-94672418 CTGCTTCAGGGGATTCAGGGAGG + Intergenic
1122113994 14:99518646-99518668 CTGCAGCGGAAGGTGCAGGAAGG - Intronic
1122134839 14:99626878-99626900 CTGCATCAGGCTCTGCAGGGTGG - Intergenic
1124782400 15:32648744-32648766 CTGCAACAGAGAATGTAGGGGGG - Intronic
1126049616 15:44674150-44674172 CTGCCACAGAAAATGCAAGGAGG + Exonic
1126097539 15:45100169-45100191 CTGCAAGAGAAGATGCAGCGAGG - Exonic
1127299291 15:57637021-57637043 CTGCCTCTGAAGCTGCAGGAGGG - Intronic
1127340671 15:58040196-58040218 CTTCGTCAGAATATGCAGAGAGG - Intronic
1127553716 15:60066490-60066512 CTGGATCAGAAGATGAAGTCTGG - Intergenic
1129207281 15:74044695-74044717 CTGCACCAGGGGCTGCAGGGAGG - Exonic
1129301825 15:74629897-74629919 CCGCATGAGGAGATGGAGGGCGG + Exonic
1129330554 15:74824897-74824919 CAGCATGAGAAAAGGCAGGGAGG + Intronic
1129595475 15:76960710-76960732 CTGAATCAGAATCTCCAGGGAGG - Intergenic
1130672819 15:85927890-85927912 CTGCATCAGAATATGGTGGAGGG + Intergenic
1132609759 16:809559-809581 CTGGATCAGCTTATGCAGGGAGG - Intronic
1132710653 16:1265652-1265674 CTCCATCTGAAGATGCAAGAAGG + Intergenic
1133170591 16:3980486-3980508 CTGCCTCAGGAGAGGCTGGGCGG + Intronic
1135661594 16:24301743-24301765 CTGCATGCGAAGATGAAGGAAGG - Intronic
1135711831 16:24723955-24723977 CTACACTAGAAGATGCAGTGGGG - Intergenic
1136530835 16:30867887-30867909 CTGACTCTGAAGATGGAGGGAGG + Intronic
1136957739 16:34804237-34804259 CTGCATCAGCAAGTGCAGGAGGG - Intergenic
1138544191 16:57706296-57706318 CTGGATCAGAGGATGGTGGGAGG - Intronic
1139360513 16:66396541-66396563 CTGGACCAGAACCTGCAGGGTGG - Intronic
1140325528 16:73998015-73998037 CTGCTGCAGAAAATGTAGGGGGG + Intergenic
1140449932 16:75062822-75062844 CTGCATTAGAAAAGGCAAGGGGG - Intronic
1140908197 16:79428223-79428245 CTGCAGCTAAAGATGTAGGGGGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141406037 16:83794013-83794035 CTGCCTCTGAAGATGAAGGAAGG + Intronic
1141554138 16:84826036-84826058 CTGGATCAGAAGCTGTGGGGTGG + Intronic
1141787336 16:86210585-86210607 CAGCATCAGAACTTGGAGGGGGG - Intergenic
1142109287 16:88322714-88322736 CTGCATCAGGAAATGCATGAAGG + Intergenic
1143789740 17:9285042-9285064 CTGAATCAGAATCTCCAGGGGGG - Intronic
1144699079 17:17325047-17325069 CTGATTCAGAAGGTGTAGGGTGG - Intronic
1146316436 17:31810833-31810855 CTTTATTAGAAGATGCAGTGTGG + Intergenic
1147403618 17:40195350-40195372 GTGCATCAGCAGTAGCAGGGAGG - Exonic
1147988965 17:44321885-44321907 CTGCATGTGTAGAGGCAGGGAGG - Intronic
1148953300 17:51333416-51333438 CTGTATCAGACTATGGAGGGAGG - Intergenic
1149068419 17:52508344-52508366 CTGCATCAGACCAGGCATGGTGG - Intergenic
1152937035 17:83145183-83145205 CTGGAGCAGAGGCTGCAGGGTGG - Intergenic
1155109831 18:22703261-22703283 CTGGATCAGAAGCTCCAGGAGGG - Intergenic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1156886552 18:42141773-42141795 CTGCATTAGAGAATGCTGGGTGG - Intergenic
1157722510 18:49936320-49936342 CTCCATGAGCAGATGCAGGGAGG + Exonic
1159104139 18:63986376-63986398 TTTCATCTGAAGATGAAGGGAGG - Intronic
1159609572 18:70510798-70510820 CTGGATCAGAATATCCTGGGAGG + Intergenic
1160169966 18:76544784-76544806 CTGGTGCAGAAGAGGCAGGGGGG + Intergenic
1160455548 18:78996499-78996521 CAGCAGCAGAAGATGCAAAGTGG + Intronic
1160543941 18:79640568-79640590 GTGCCTCAGACGCTGCAGGGAGG - Intergenic
1161042747 19:2118692-2118714 CTGCAGCAGAAGGAGCAGGCCGG - Exonic
1161457455 19:4376690-4376712 CAGCATGGGAAGATCCAGGGAGG - Intronic
1163130757 19:15271438-15271460 CAACATCAGAAGCTACAGGGAGG - Intronic
1163592676 19:18203205-18203227 CTGCATCACATGATACAGGAGGG + Intronic
1165287541 19:34854181-34854203 CTGCATCAGAAGATGCAGGGTGG + Intergenic
1166583900 19:43928359-43928381 CTCCATCAGAGGGTGGAGGGTGG + Intronic
1167660751 19:50794675-50794697 CTGCATGGGATGATGCTGGGAGG + Intronic
1168259482 19:55185523-55185545 CTGGATCAGACCATGGAGGGAGG - Exonic
1168527112 19:57098097-57098119 CTGGAGCCGGAGATGCAGGGAGG - Intergenic
925366406 2:3314960-3314982 CAGCAGCAGAAGATGCTGTGTGG - Intronic
926719189 2:15946274-15946296 CTGCATCCCAGGATGCTGGGTGG + Exonic
926753822 2:16220371-16220393 CTGCCTGACAGGATGCAGGGTGG + Intergenic
927662410 2:25004067-25004089 CTCCATCAGAAGTACCAGGGAGG + Intergenic
928198285 2:29230401-29230423 CTGCAGCAGATGATGCATGCTGG + Intronic
929342295 2:40835840-40835862 CTGCTTTAGAAGGTGGAGGGAGG + Intergenic
930031469 2:47060685-47060707 CTGGCTCTGAGGATGCAGGGAGG + Intronic
932104894 2:68933317-68933339 CTGCATCATTAGAGGCAGTGAGG + Intergenic
932469403 2:71944119-71944141 CTGCGTTAGGAGTTGCAGGGAGG - Intergenic
932877040 2:75463619-75463641 ATGCATAAGGAGATGCAGGTTGG - Intergenic
935390085 2:102541834-102541856 CTGAATCAGCAGATGTGGGGTGG + Intergenic
935687962 2:105701233-105701255 CTGCATCAGATGCTGCAAGCAGG + Intergenic
937961468 2:127463529-127463551 CTTAATCAGCAGATGCTGGGTGG + Intronic
938233284 2:129680236-129680258 CTTAGTCAGGAGATGCAGGGAGG - Intergenic
938600184 2:132829720-132829742 CTGAATCAGGAGGTGTAGGGTGG + Intronic
939455349 2:142427208-142427230 CTGAATTAAAAGATGCAAGGTGG - Intergenic
940303333 2:152198856-152198878 AGGCAGCAGAAGATGCAAGGAGG - Intergenic
940873322 2:158878248-158878270 CTGGATCATAATATCCAGGGGGG - Intergenic
941956944 2:171214589-171214611 CTGAATCAGAAATTGTAGGGTGG - Intronic
942111691 2:172688844-172688866 CTTCAGCAGAAGATGCTGTGGGG - Intergenic
942231176 2:173862068-173862090 CTGATTCAGAAGATCCAGTGGGG - Intergenic
946192098 2:218012958-218012980 CTGCATCAGGCCATGCACGGTGG + Intergenic
948313918 2:237012325-237012347 CTGCATGAGAAGAGGAAGGGAGG + Intergenic
948469165 2:238166424-238166446 CTGCATCTTAAGATCCAGGTGGG - Intronic
949070368 2:242020826-242020848 GTGCAGCTGAAGACGCAGGGGGG + Intergenic
1169304552 20:4477149-4477171 TTGCCTCAGAAGAAGCAGGTGGG + Intergenic
1170841335 20:19926963-19926985 ATGCATAGGAAGCTGCAGGGAGG - Intronic
1171335516 20:24381913-24381935 GTGCATCAGAGGATGAAGGTGGG - Intergenic
1172192816 20:33072081-33072103 CTGCAACAGAACACACAGGGTGG - Intronic
1174115185 20:48222011-48222033 CTGCATCAGAACATGGTGGAAGG + Intergenic
1176991969 21:15507878-15507900 CTGCATCATAAGATGGTGGAAGG - Intergenic
1177590262 21:23154857-23154879 CTGAATCAGAAGAGGCAGCAGGG + Intergenic
1179603793 21:42499093-42499115 CTGCTGCAGGAGATGCCGGGAGG - Intronic
1181037398 22:20176496-20176518 CTGCACAAGAGGATCCAGGGTGG + Intergenic
1181536826 22:23550642-23550664 ATGCATGAGAAGATGGAAGGAGG - Intergenic
1183288356 22:36982137-36982159 CCTCATGAGGAGATGCAGGGAGG - Intergenic
1183596414 22:38815176-38815198 CTGCCTCAGAACCTCCAGGGTGG + Intergenic
1185188413 22:49417384-49417406 GTGCATCAGAAGCTGGAGGCAGG - Intronic
950393505 3:12715663-12715685 CTGAATCAGAAATTCCAGGGTGG + Intergenic
950793183 3:15489604-15489626 CTGGATCAGAAGAAGCGTGGTGG - Exonic
951159395 3:19398558-19398580 CTTCATCATAAGATACAGTGAGG + Intronic
953168595 3:40487339-40487361 CAGCATCAGAAGCTCCATGGTGG + Exonic
953614837 3:44480584-44480606 CTGCAGAAAAAGATGGAGGGTGG - Intergenic
956330451 3:68101160-68101182 CTGTATCAGAGGATGGAGGGTGG - Intronic
956746510 3:72315091-72315113 TTGCCTCAGAAGGTGCTGGGAGG - Intergenic
956873542 3:73440987-73441009 CTGCACCAGAAAATGCTGGAAGG - Intronic
957174538 3:76789160-76789182 CTGTATCCTTAGATGCAGGGTGG + Intronic
960639419 3:119811975-119811997 CTGAATCTGAAGCTCCAGGGAGG + Intronic
960686942 3:120304575-120304597 GTGCGTGAGAAGCTGCAGGGTGG + Intergenic
961578143 3:127855423-127855445 CTGGCTCTGAAGATGGAGGGAGG - Intergenic
962075267 3:132074991-132075013 CTGTATCATTAGATGTAGGGAGG + Intronic
962092753 3:132262461-132262483 TTGCATCAGAATATCTAGGGTGG + Intronic
963251761 3:143110314-143110336 ATGCAACAGAAAAGGCAGGGGGG + Intergenic
964543647 3:157807924-157807946 CTGATTCAGGAGATCCAGGGTGG - Intergenic
964697289 3:159523991-159524013 CTGCATCAGGAAATGCTGAGTGG - Intronic
965824325 3:172715603-172715625 CTGGAGCATCAGATGCAGGGAGG + Intergenic
968049688 3:195645907-195645929 GTGCAGCAGAAGACTCAGGGAGG + Intergenic
968304447 3:197640075-197640097 GTGCAGCAGAAGACTCAGGGAGG - Intergenic
968934839 4:3604620-3604642 CTGCCTCAGAACCAGCAGGGAGG - Intergenic
968963201 4:3756109-3756131 CTGCATGAGAACTTGCAGGGTGG + Intergenic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
970398251 4:15692896-15692918 CTGGCTCTGAAGATGCAGGAAGG - Intronic
973791894 4:54385496-54385518 TGGCATCAGAAGGTGAAGGGAGG - Intergenic
978165612 4:105603227-105603249 CTGCTTCATAAGTTGCTGGGAGG - Intronic
980932443 4:139194617-139194639 ATGCATTAGAAGATGCAAGCTGG + Intergenic
984019570 4:174468602-174468624 GTGAATCAGAGGCTGCAGGGAGG + Intergenic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
984841909 4:184076702-184076724 CTGAATCGGAATCTGCAGGGTGG + Intergenic
984886634 4:184455443-184455465 TTGCATCAGAAGGTGGAAGGAGG - Intronic
985741709 5:1621171-1621193 GTGCAGCTGAAGATTCAGGGAGG - Intergenic
985742013 5:1623570-1623592 GTGCAGCTGAAGATCCAGGGAGG - Intergenic
988054635 5:26078159-26078181 GTGCCTCAGAAGATGAAGGCAGG + Intergenic
988507233 5:31834012-31834034 CTGCATCAGAGGAGGAAGAGTGG - Intronic
989105429 5:37858742-37858764 CTGCATCAGAATCACCAGGGTGG + Intergenic
989108977 5:37889078-37889100 CTGCCTCTGGAGATGGAGGGAGG + Intergenic
990087469 5:51996338-51996360 CTGCATCCAAAGATGCAGTATGG + Intergenic
994946807 5:106404605-106404627 CAGTAGCAGGAGATGCAGGGAGG + Intergenic
995376467 5:111479908-111479930 AGGCATGAGAAGAGGCAGGGAGG - Intronic
996427202 5:123327130-123327152 CTGCATAAAATGATGTAGGGAGG + Intergenic
998141530 5:139702274-139702296 CTGGAGCAGAAGGAGCAGGGAGG - Intergenic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
998676143 5:144410116-144410138 CTGGATCAGAGGTTGCAAGGAGG + Intronic
1000258027 5:159559363-159559385 CTGACTCAGTAGATGTAGGGTGG - Intergenic
1001674342 5:173499678-173499700 CTGGATTGGAAGCTGCAGGGAGG + Intergenic
1005498206 6:26407267-26407289 CTGTAGCAGACGATGAAGGGAGG + Intronic
1006113376 6:31762213-31762235 TTGCAGGAGAAGATGCAGAGAGG - Intronic
1008370125 6:50722519-50722541 GAGCCTCAGAAGATTCAGGGGGG - Intronic
1008505725 6:52227764-52227786 TGACAGCAGAAGATGCAGGGTGG - Intergenic
1008558336 6:52697551-52697573 GTGCAGAAGAAGGTGCAGGGAGG - Intergenic
1011391244 6:86856066-86856088 ATGCATCATAAGATTCAGGATGG + Intergenic
1014045609 6:116882184-116882206 ATACATCAGCAGAGGCAGGGAGG - Intronic
1014337136 6:120150699-120150721 CTTCATCAGATGAAGTAGGGAGG - Intergenic
1015593232 6:134842518-134842540 CTGGATCAGCAGATCCAGGCAGG + Intergenic
1015829996 6:137358461-137358483 CAGCTGCAGAGGATGCAGGGAGG - Intergenic
1016072556 6:139757368-139757390 TTGAATCAGAATATGGAGGGTGG - Intergenic
1017323573 6:153120570-153120592 CTTCATCAGTCCATGCAGGGGGG - Intronic
1017573867 6:155779541-155779563 CTGCACCAAAAGATGGAGGGCGG + Intergenic
1017817568 6:158026819-158026841 CTGTGTCAGAAGAGGCAGGTGGG + Intronic
1018517817 6:164606209-164606231 CTGGATTAGAAGATGAAGGAAGG + Intergenic
1020211500 7:6161366-6161388 CTGCATCAGGAGATGGAGTGGGG + Exonic
1020912843 7:14155019-14155041 CTGAATCAGAAGATCTGGGGTGG - Intronic
1021729759 7:23585024-23585046 CTGCTATAAAAGATGCAGGGAGG + Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022226723 7:28371168-28371190 CAGCAGCAGAAGATTCAGGGAGG + Intronic
1022506482 7:30911225-30911247 AGGCATCAGAAGTTGCAGAGAGG - Intergenic
1022704352 7:32788551-32788573 CTGCATCAGAATCACCAGGGAGG + Intergenic
1025158338 7:56630545-56630567 CTGTACCTGAAGCTGCAGGGTGG - Intergenic
1025839675 7:65134025-65134047 CTGCATCAGAAGAGGTACAGAGG - Intergenic
1025883392 7:65561940-65561962 CTGCATCAGAAGAGGTACAGAGG + Intergenic
1025890054 7:65640666-65640688 CTGCATCAGAAGAGGTACAGAGG - Intergenic
1026152376 7:67799092-67799114 GAGCATCAGAAGATGCTGAGAGG - Intergenic
1026540404 7:71275208-71275230 CAGAGTCAGAAGTTGCAGGGGGG + Intronic
1028938061 7:96487828-96487850 CTGATTCAGAAGATCTAGGGTGG + Intronic
1029032997 7:97488440-97488462 CTGCCCCAGCAGTTGCAGGGAGG + Intergenic
1031537467 7:122953104-122953126 CTTCATCAGAAGATTAAAGGTGG + Intergenic
1031852429 7:126881318-126881340 CTGCATCAGAAGAGGTACAGAGG + Intronic
1034982751 7:155489233-155489255 CTGCTTGAGAAGTTGCAGAGGGG - Intronic
1035694704 8:1586364-1586386 CTGGCTCTGAAGATGCAGGCAGG - Intronic
1036463380 8:8974037-8974059 CTGCATCCCAGGAAGCAGGGTGG - Intergenic
1039417933 8:37411620-37411642 GTGGAGCAGAAGCTGCAGGGAGG + Intergenic
1041333224 8:56751140-56751162 CTGCATCATAACATGGAGGAAGG + Intergenic
1041746331 8:61212398-61212420 ATGCCTCAGCAGATGCAGCGGGG + Intronic
1041961878 8:63627139-63627161 CTGCATAAGATGCTGCAGTGTGG - Intergenic
1042203657 8:66306489-66306511 CTGCATCATAACATGGCGGGAGG + Intergenic
1042482863 8:69323584-69323606 GTGCTGCTGAAGATGCAGGGAGG + Intergenic
1042482868 8:69323631-69323653 GTGCTGCTGAAGATGCAGGGAGG + Intergenic
1042661531 8:71159920-71159942 CTGAATCAGAAATTGCAGGATGG + Intergenic
1042985658 8:74580279-74580301 CTGGCTCTGAAGATGGAGGGGGG - Intergenic
1046315984 8:112502239-112502261 CTGTATCAGAAGATGCTTGGGGG - Intronic
1047940277 8:129822566-129822588 CTGATTCAGAAGATACAGTGAGG + Intergenic
1048565638 8:135593772-135593794 CTGCATCAGGAAATCCAGGCTGG - Intronic
1048787599 8:138066933-138066955 CAGCATCAGAGGCTGGAGGGTGG + Intergenic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1049675268 8:143886369-143886391 TTCCATCAGAAGATGCTGGGTGG + Intergenic
1050118278 9:2282689-2282711 CTGCATCAGAAACTGCTGGGTGG + Intergenic
1050429752 9:5550626-5550648 CTGCCTCTGAAGATAGAGGGAGG - Intronic
1051707465 9:19895761-19895783 CCGCATGAGGAGATGGAGGGTGG - Intergenic
1052433322 9:28394639-28394661 ATCCATCAGAAGATGTATGGGGG + Intronic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1054455336 9:65427358-65427380 CTGCCTCAGAACCAGCAGGGGGG + Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1054961978 9:70979408-70979430 CTGCATTAGAGGAGGCAGAGGGG + Intronic
1058109372 9:101015476-101015498 CTACATCAGAAGATGCACACTGG + Intergenic
1058775004 9:108274310-108274332 CTTCATCTGAAGCTTCAGGGTGG - Intergenic
1060962109 9:127688328-127688350 CTGACTCAGAATATGCAGGGCGG - Intronic
1061341297 9:129984086-129984108 CTGCAACAGAAGGTCTAGGGTGG + Intronic
1062026829 9:134344414-134344436 CTGACTCAGCAGCTGCAGGGTGG + Intronic
1062617759 9:137405658-137405680 TTTCAGCAGAAGATCCAGGGAGG - Intronic
1203613363 Un_KI270749v1:28641-28663 CCGCATCAGCAAATGCAGGAGGG - Intergenic
1189026802 X:37403756-37403778 TTCCATCAGAAGAAGCAAGGAGG + Intronic
1189625792 X:42895411-42895433 CTGGATAAGAAGATGCTGTGAGG + Intergenic
1190451324 X:50584119-50584141 CTGAATCAGAAGATTCATGATGG + Intergenic
1190577718 X:51857956-51857978 CAGCATCAGAAAATACAGAGTGG + Intronic
1191741786 X:64443934-64443956 CAGCATCAGAAAAGGCAGTGGGG + Intergenic
1191801165 X:65081318-65081340 CTGAATCAAAAGATGTAGAGAGG + Intergenic
1193249552 X:79272985-79273007 CTGGAAAAGAAGATGTAGGGTGG - Intergenic
1195005195 X:100678728-100678750 CTGCTTCAGCAGATTCAAGGAGG - Intronic
1196244523 X:113384732-113384754 GTGCATCAGAATATGCTGGAAGG + Intergenic
1196366544 X:114930744-114930766 CTGCATCATAATATGGAGGAAGG + Intergenic
1196631504 X:117945364-117945386 CTGCATCACAAAATCCATGGTGG + Intronic
1197264059 X:124347313-124347335 CTACATCAGCAGATCCAGAGAGG - Intronic
1199533038 X:148871102-148871124 CTGCATGAGAAAAAGCAGTGTGG + Intronic
1199673531 X:150166018-150166040 CTCCATCAGGAGATGGAGGCAGG - Intergenic
1200058531 X:153473893-153473915 CTGCATGCCAGGATGCAGGGTGG - Intronic
1200134394 X:153867855-153867877 CTGCGTCAGCAGGTGCAGGTCGG + Exonic