ID: 1165296142

View in Genome Browser
Species Human (GRCh38)
Location 19:34927292-34927314
Sequence TCGCGGATGCACACCGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165296142_1165296146 -8 Left 1165296142 19:34927292-34927314 CCGGGGCCGGTGTGCATCCGCGA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1165296146 19:34927307-34927329 ATCCGCGAAGACTGGGTGCATGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165296142 Original CRISPR TCGCGGATGCACACCGGCCC CGG (reversed) Intronic
902022070 1:13353572-13353594 TGGAGGACGCACACCGGCACTGG - Intergenic
1065598862 10:27348004-27348026 TTGCAGATGCAGAACGGCCCAGG + Intergenic
1076451690 10:130560970-130560992 TCCCGGATGGACACTGGCACAGG + Intergenic
1077485160 11:2835119-2835141 CCGCAGCTGCAAACCGGCCCTGG + Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1112365625 13:98752785-98752807 TCGCGCGTGGACACCAGCCCCGG + Intergenic
1118324022 14:64769436-64769458 TCGGGGCTACACACAGGCCCGGG - Intronic
1123931200 15:25172488-25172510 TGGCTGATGGACACTGGCCCAGG - Intergenic
1123941425 15:25218469-25218491 TGGCTGATGGACACTGGCCCAGG - Intergenic
1123944107 15:25230699-25230721 TGGCTGATGGACACTGGCCCAGG - Intergenic
1123946555 15:25241599-25241621 TGGCTGATGGACACTGGCCCAGG - Intergenic
1127592348 15:60437692-60437714 TCGCTGCTGCACTCCAGCCCAGG - Intronic
1136561569 16:31042251-31042273 TCGCTGATGCACATTGGACCGGG + Intronic
1138391779 16:56675763-56675785 ACCCGGATGCACACGGACCCGGG + Intronic
1142122497 16:88393775-88393797 TGGCCGTCGCACACCGGCCCTGG - Intergenic
1146339635 17:32007740-32007762 TGGCGGCTGCCCACCTGCCCCGG - Intergenic
1152579086 17:81158090-81158112 TCGCGGATGCATGCCGGCCACGG + Intronic
1160054237 18:75464452-75464474 TCCCGCATGCACACTGGCCTTGG + Intergenic
1160237816 18:77099766-77099788 CTGCAGATGCACACCTGCCCTGG + Intronic
1160701537 19:509870-509892 TGGCAGATGCATCCCGGCCCTGG + Intronic
1160719628 19:591480-591502 CCACCGGTGCACACCGGCCCCGG - Intronic
1163890770 19:20010612-20010634 TCGCGCCTGCACTCCAGCCCGGG + Intronic
1165296142 19:34927292-34927314 TCGCGGATGCACACCGGCCCCGG - Intronic
1166043813 19:40218011-40218033 TCGCTGAGGCGCGCCGGCCCGGG + Exonic
925855473 2:8125136-8125158 GCGCAGAAGCACACTGGCCCTGG - Intergenic
928373391 2:30757180-30757202 TCACGGATGGACACAGACCCTGG + Intronic
1179920890 21:44506722-44506744 CCGCGGATTCACACTGACCCGGG - Intronic
1182442674 22:30373393-30373415 AGGCAGATGCACACCGGACCTGG - Intronic
1183891083 22:40929232-40929254 TCGCTATTGCACACCAGCCCCGG - Exonic
1184572074 22:45331668-45331690 TCACGGAATGACACCGGCCCAGG - Intronic
970831081 4:20340641-20340663 TCGCCGCTGCACTCCAGCCCGGG - Intronic
974009342 4:56592847-56592869 GCTCGGAGGCACATCGGCCCTGG + Intronic
980120323 4:128721278-128721300 GCGCCGCTGCACACCAGCCCCGG - Intergenic
984594977 4:181656526-181656548 CCGCGGATGCAGATGGGCCCAGG + Intergenic
1003552369 6:7109602-7109624 TCACGGATGCACGGCGGCCGAGG - Intronic
1007368265 6:41409388-41409410 TCGCGGAGACCCACAGGCCCGGG + Intergenic
1049989122 9:976156-976178 TTGCGGTTGCACCCCGGACCTGG - Intergenic
1050537741 9:6645288-6645310 GCTCGGAGGCACATCGGCCCTGG - Exonic
1060794231 9:126503727-126503749 TCGCTGATCCTCCCCGGCCCAGG + Exonic
1196295378 X:113990938-113990960 TGGAGGATCCACACCGGCACCGG - Intergenic