ID: 1165299968

View in Genome Browser
Species Human (GRCh38)
Location 19:34962595-34962617
Sequence CTGTGGGTCTGACAGACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165299962_1165299968 11 Left 1165299962 19:34962561-34962583 CCTGGATTGTCAGTCCAGATAGC 0: 1
1: 0
2: 1
3: 12
4: 76
Right 1165299968 19:34962595-34962617 CTGTGGGTCTGACAGACAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 230
1165299964_1165299968 -3 Left 1165299964 19:34962575-34962597 CCAGATAGCAATCTGGCTTCCTG 0: 1
1: 0
2: 0
3: 9
4: 160
Right 1165299968 19:34962595-34962617 CTGTGGGTCTGACAGACAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165299968 Original CRISPR CTGTGGGTCTGACAGACAGC AGG Intronic
900330706 1:2133211-2133233 CTGAGGGACTGACGCACAGCTGG - Intronic
900590350 1:3456679-3456701 CTGTGTGTCTGTCCTACAGCGGG + Intronic
900758342 1:4453517-4453539 CTGAGGGTCTGTCACACAGTAGG + Intergenic
900905040 1:5551265-5551287 CTCTGGGGCTGACAGGTAGCTGG - Intergenic
901842836 1:11964621-11964643 CTGTGGGAGAGACAGAAAGCGGG - Intronic
902463961 1:16603149-16603171 CTGTTGTTCTCACTGACAGCAGG + Intronic
902542245 1:17163580-17163602 GTGCGGGGGTGACAGACAGCAGG - Intergenic
903027052 1:20436859-20436881 CTGTGGGCCTCACACACAGTAGG - Intergenic
903157136 1:21453526-21453548 CTGTTGTTCTCACTGACAGCGGG - Intronic
904581512 1:31547520-31547542 CTCTGGGTCAGTGAGACAGCTGG + Intergenic
905820401 1:40985703-40985725 CTGAGGGTCACACTGACAGCTGG + Intronic
906066085 1:42981090-42981112 CTCTGGGACTGCCAGACACCTGG + Intergenic
906951411 1:50336966-50336988 TTGTGGGGCAGACAGACAGCAGG - Intergenic
907328384 1:53655737-53655759 ATGGGGGTCTGGCACACAGCAGG + Intronic
913497863 1:119445125-119445147 CTGTGGCTCTGACTGACACTGGG - Intergenic
913508921 1:119545065-119545087 CTGTGGCTCTGACAGAGATTGGG - Intergenic
914802776 1:150973360-150973382 CGGTGGGTTTGAGAGACAGCTGG + Intronic
915928831 1:160045335-160045357 TTGTGTGCCTGACAGAAAGCTGG + Intronic
917836159 1:178943081-178943103 CTGTGGCTCTGCCAATCAGCCGG + Intergenic
918950120 1:191126027-191126049 CTTTTGGTCTGACAGTCAGTGGG - Intergenic
922782616 1:228264697-228264719 CTGTGCATGTGACAGACACCCGG - Intronic
923525660 1:234770588-234770610 CTGGGGGCCTGGCACACAGCAGG - Intergenic
924508429 1:244708422-244708444 CTGTGGGTCAGAGCAACAGCTGG - Exonic
1062795763 10:343965-343987 CTGTGGGTCACAAAGCCAGCGGG + Intronic
1064028293 10:11866821-11866843 CTCTGGGTCTCACAGACACCAGG - Intronic
1067243896 10:44519834-44519856 CAGTGGGTTTTACAGCCAGCCGG + Intergenic
1067439636 10:46301367-46301389 CTGAGGCTGTGAGAGACAGCAGG - Intronic
1069945998 10:71986193-71986215 CTGGCGCTCTTACAGACAGCGGG - Intronic
1069990161 10:72310296-72310318 CTGTGGTTAGGACAGAGAGCAGG + Intergenic
1070735571 10:78861579-78861601 GTGTGGGACTGACAGACTGCTGG + Intergenic
1072010600 10:91299708-91299730 CTGTGGTTCTCAAAGTCAGCCGG + Intergenic
1072623618 10:97096943-97096965 CTGTACGTTTGGCAGACAGCTGG - Intronic
1076218096 10:128711710-128711732 ATGAGGGTCTTACAGACAGTAGG - Intergenic
1076225313 10:128770167-128770189 GTGTGGGTCTGACAGCCCGTGGG + Intergenic
1080458031 11:32432717-32432739 CTGTGGGTTTTGCAGCCAGCAGG - Intronic
1081611077 11:44563828-44563850 CTGCGGGTATGACACACTGCTGG + Intergenic
1081752538 11:45522194-45522216 CTGTGGGACTGAAAGTCAGGTGG - Intergenic
1082029203 11:47592729-47592751 CTGTGTCTCTTAGAGACAGCAGG + Intronic
1084960340 11:72713104-72713126 CTCAGGGTCTGACAGGCAGCTGG + Intronic
1085253489 11:75159222-75159244 CTGTGTGTCTGACTGTCAGTCGG - Intronic
1085824155 11:79825571-79825593 CTGTGGGTCTTACAGAAAGAAGG - Intergenic
1089340613 11:117754852-117754874 CTGTGGGTCACACAGAAGGCAGG - Intronic
1089705519 11:120275020-120275042 CTGTGGACCAGACAGACACCAGG - Intronic
1090248127 11:125231535-125231557 CTGTGAGGATCACAGACAGCTGG + Intronic
1091118165 11:133034331-133034353 GTGTGTGTGTGACAGACAGAGGG + Intronic
1091890202 12:4047522-4047544 CCTTGGGTCTGAGAGCCAGCTGG - Intergenic
1093907989 12:24714446-24714468 CTGTGGGTCTTAGTAACAGCGGG - Intergenic
1094302800 12:28984843-28984865 CTGTAGGTCTGTCAGAGAGGAGG + Intergenic
1094650084 12:32367774-32367796 CTATGGATCTGACATGCAGCTGG - Intronic
1095638611 12:44460374-44460396 CTGTTAGTCAGACAAACAGCTGG - Intergenic
1096474310 12:51898774-51898796 CTGTGGGTTTTACAGCCGGCTGG + Intergenic
1096839885 12:54373741-54373763 CTGTGGGGAGGACAGACAGTGGG + Intronic
1097180574 12:57169373-57169395 CCGTGGGTCTGAAAGACAGATGG - Intronic
1099822440 12:87730018-87730040 CTGTGGGTCTGTCATTCCGCTGG - Intergenic
1101833081 12:108274492-108274514 ATGTGGGGTTGACAGTCAGCAGG + Intergenic
1103183845 12:118938704-118938726 ATGTGGGTCTCACAGCCATCCGG + Intergenic
1104477610 12:129083550-129083572 CTGTGGGTCTCAGGGACAGTTGG - Intronic
1104504870 12:129321906-129321928 CTGTGTGTCCGACAAAGAGCAGG - Intronic
1108022934 13:46147022-46147044 CTGTGGCTGTGACAAACTGCCGG + Exonic
1109931245 13:69221617-69221639 ATGTGGGAGTGAGAGACAGCTGG + Intergenic
1112304662 13:98262778-98262800 CTTCGGGTCTGACAGAGATCAGG - Intronic
1112602430 13:100869535-100869557 CTGTGGATCTGGCACACAGTGGG - Intergenic
1113447597 13:110381286-110381308 CGGTGGGTGTGACATAGAGCCGG - Intronic
1113460084 13:110476154-110476176 GTGGGGATCTGACAGACACCAGG - Intronic
1113862487 13:113497378-113497400 CTGCAGGTCTCACACACAGCTGG - Intronic
1113862490 13:113497430-113497452 CTGCAGGTCTCACACACAGCTGG - Intronic
1114769481 14:25412065-25412087 CTGAGGATCTCACAGGCAGCAGG + Intergenic
1117111085 14:52455410-52455432 CTGTGTGTCTGGCAAGCAGCAGG + Exonic
1118476328 14:66120853-66120875 CTGTGGTTCTGACAGGCATAGGG + Intergenic
1120681217 14:87482987-87483009 CTGTGGCTCAGACACAAAGCAGG - Intergenic
1121949004 14:98152771-98152793 CTGTGTGAGTGACCGACAGCAGG + Intergenic
1122019629 14:98826908-98826930 CTGTGTGTTTGGCACACAGCAGG - Intergenic
1122075454 14:99232088-99232110 CTGGTGGTCTGCCAGACAGGAGG - Intronic
1125475725 15:40046949-40046971 CTGTGGGTCTGTCACAGAGGTGG - Intergenic
1127165463 15:56241709-56241731 GTGTGTGTGTGACAGAAAGCAGG - Intronic
1127174382 15:56338382-56338404 CTGCAGGTCTGATAGACAGGTGG - Intronic
1128617569 15:69122034-69122056 CTGTGGAGCAGTCAGACAGCGGG + Intergenic
1130971793 15:88739516-88739538 CTGTGGGTCTAACAGGCAGTGGG + Intergenic
1132413642 15:101604748-101604770 ATGTGGGTCTGGAAGAGAGCTGG - Intergenic
1134077127 16:11299866-11299888 CTGTGGGTCTTAGAGAAATCAGG - Intronic
1135771909 16:25224313-25224335 CAGTGGGGCAGAGAGACAGCTGG - Intronic
1136186491 16:28591567-28591589 CTGTGGGGCAGGCAGACAGGAGG - Intronic
1136188976 16:28604291-28604313 CTGTGGGGCAGGCAGACAGGAGG - Intergenic
1136655248 16:31705657-31705679 CCTTGGGTCTCACAGACGGCAGG + Intergenic
1137721188 16:50628408-50628430 CTGTGGGACTTACAGGCAGGAGG + Intronic
1138729435 16:59178580-59178602 CTGTGGGTCAGACATTCAACAGG + Intergenic
1139340616 16:66265654-66265676 CTGTGCGGCTGGCAGAGAGCAGG - Intergenic
1140558922 16:75954621-75954643 CTGTGCTTCTGATACACAGCTGG + Intergenic
1141476885 16:84280036-84280058 ATGTGGGGCTCACACACAGCAGG - Intergenic
1141504106 16:84463364-84463386 GGGTGGGTCTGGCAGGCAGCTGG - Intronic
1141569051 16:84923123-84923145 CTCTGGGGCTGATGGACAGCTGG - Intergenic
1142420729 16:89967905-89967927 CTGTGGGTCTGTGGCACAGCAGG + Exonic
1142497530 17:314301-314323 CTGTGGGGTTGAGAGACAGGAGG + Intronic
1143393897 17:6576746-6576768 CAGTGGGTCTGAAAGGCAGAAGG - Intergenic
1144794455 17:17881615-17881637 CTGTGGGCTTGACAGGCAGATGG - Intronic
1145005716 17:19336614-19336636 CTCTGGGACTGAGAAACAGCTGG - Exonic
1145026451 17:19471321-19471343 CTTTGAGTGTGGCAGACAGCGGG + Intergenic
1147242736 17:39101319-39101341 CAGGGTGTCTGTCAGACAGCAGG - Intronic
1148356253 17:46977916-46977938 CTGTGGGACAGCCAGACAGCTGG - Intronic
1148644437 17:49211043-49211065 CTGAGGCTCTGAGAGACAGAAGG - Intronic
1151344327 17:73492500-73492522 CTGGTGGGCTCACAGACAGCTGG - Intronic
1152255574 17:79237498-79237520 CTGTGGGTGAGACAGGCAGATGG - Intronic
1152448041 17:80357415-80357437 CTGAGTGTCTGATAGACAGGTGG - Intronic
1153336867 18:3933759-3933781 CTGTGGTTCAGACAGAATGCAGG + Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1154376809 18:13817530-13817552 TTGTGGTTCTTGCAGACAGCAGG + Intergenic
1156613256 18:38752205-38752227 CTTTGGCTCTGGCAGGCAGCAGG + Intergenic
1158401069 18:57121982-57122004 CTGTGGGTCTTTCACCCAGCTGG - Intergenic
1158507280 18:58057858-58057880 TTTTGGGTCTAACAGACAACAGG + Intronic
1160776599 19:859457-859479 CTGTGAGCCTGACAGCCTGCTGG - Intergenic
1161617779 19:5281792-5281814 CTCTAGGTCAGACAGGCAGCTGG - Intronic
1164518764 19:28960616-28960638 CTGTGGGTCTTCAAGGCAGCAGG + Intergenic
1164886154 19:31780262-31780284 CTGTGGGGCAGACACACACCCGG + Intergenic
1165299968 19:34962595-34962617 CTGTGGGTCTGACAGACAGCAGG + Intronic
1166105216 19:40594846-40594868 CTGTGTGTCTCACAGTGAGCGGG + Intronic
1168511654 19:56978371-56978393 CTGTGCTTCTCACAAACAGCAGG + Intergenic
1202679619 1_KI270711v1_random:40589-40611 CTGTTGTTCTCACTGACAGCAGG + Intergenic
927325223 2:21797607-21797629 TTGTGGGTTTGATAGATAGCAGG - Intergenic
929906301 2:46049362-46049384 CTGTGGGCATGAGAGAGAGCTGG - Intronic
930738481 2:54803825-54803847 CTGTGTGTGTGAAATACAGCTGG + Intronic
931636495 2:64345100-64345122 GTGTGGGGCTGACAGACAACAGG - Intergenic
932579039 2:72981671-72981693 CTTGGGGCCTGACACACAGCAGG + Intronic
933779140 2:85789263-85789285 CTTAGTGTCTGACAGGCAGCTGG - Intergenic
938081791 2:128374105-128374127 CTGTGGGGCTGACACACACTTGG + Intergenic
938949959 2:136246260-136246282 GTGGTGGTCTGACAGGCAGCGGG + Intergenic
939891320 2:147739800-147739822 CTGTGGATTTGACAGGAAGCTGG - Intergenic
941253334 2:163195632-163195654 CTGTGTTTGTGACAGACAGCAGG + Intergenic
942485707 2:176437799-176437821 CTGTGGGTTTTAGAGTCAGCAGG + Intergenic
946284462 2:218692673-218692695 CTGTGGGACTGCCCGACTGCTGG + Exonic
946360116 2:219214304-219214326 CACTGGGGCTGACAGAGAGCTGG - Intronic
946464870 2:219902931-219902953 GTGTGTGTGTGACAGACAGAGGG + Intergenic
1169422413 20:5471117-5471139 CTGTGCGTTTGATAGGCAGCTGG + Intergenic
1169427068 20:5504664-5504686 CTGTGCGTTTGACAGGCAGTTGG - Intergenic
1172183824 20:33019417-33019439 CAGTGGGTCTTACAGGCCGCTGG - Intronic
1172759848 20:37314323-37314345 CTGATTGTCTGGCAGACAGCTGG + Intronic
1173072990 20:39787203-39787225 CTGTGGGCCTGATCAACAGCTGG + Intergenic
1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG + Intronic
1173553114 20:43947059-43947081 CTCTGGGTCTGAAAGCCTGCAGG + Intronic
1173558243 20:43983080-43983102 CTGTGAGGCTCACAGCCAGCAGG - Intronic
1173847025 20:46194584-46194606 CTGTGTGCCTGACACACAGTAGG - Intronic
1174125206 20:48299220-48299242 GTTTGGTTCTGACAAACAGCAGG + Intergenic
1174600981 20:51724624-51724646 CTGTGGGGCTGACATTCAGAAGG - Intronic
1175949755 20:62577045-62577067 CTGAGGGTCTGGGAGTCAGCTGG - Intergenic
1176312324 21:5158752-5158774 CTGTGTGTTTTGCAGACAGCTGG - Intergenic
1176953889 21:15077549-15077571 CTGTGTATCTGGAAGACAGCAGG - Intergenic
1178687419 21:34722669-34722691 CACTGTGCCTGACAGACAGCTGG - Intergenic
1179657703 21:42855383-42855405 TTGTGGGTCTGCCAGCCAGGTGG - Intronic
1179824139 21:43954616-43954638 CTGTGGGCCGTGCAGACAGCTGG + Intronic
1179838803 21:44056704-44056726 CTGTGAAGCTGACAGACTGCAGG + Intronic
1179844724 21:44103278-44103300 CTGTGTGTTTTGCAGACAGCTGG + Exonic
1179856290 21:44164132-44164154 CTGTGGGGCAGAGACACAGCAGG - Intergenic
1180840173 22:18955406-18955428 GTGTGGGTCTGGCAGGGAGCCGG - Intergenic
1181061720 22:20285008-20285030 GTGTGGGTCTGGCAGGGAGCCGG + Intergenic
1181712221 22:24697749-24697771 CTGTGGGCCTCACAGCCACCTGG - Intergenic
1183776339 22:39968600-39968622 TTGTGGATCTGACAGCCAGATGG - Intronic
1184742689 22:46438228-46438250 CTGTGGGGATGAGAGGCAGCTGG + Intronic
1184797532 22:46740707-46740729 CCCTGGGTCTGACACACAGCAGG - Intergenic
950637284 3:14324008-14324030 CTGTGGGTCACACAGAAAGTGGG + Intergenic
950640812 3:14346975-14346997 CTCTGGGCCTGACAGTGAGCAGG + Intergenic
950669460 3:14517373-14517395 CTCTGGGTCTCAAAGACTGCAGG + Intronic
950954411 3:17036154-17036176 CTGTGGGGAGGACAGAGAGCTGG - Intronic
951073552 3:18362154-18362176 CTGTGGGACTGAACCACAGCAGG - Intronic
951825678 3:26865560-26865582 CTCTGTGTCTGACAGACAAGTGG - Intergenic
953970176 3:47341362-47341384 CTGTGGATCAGACAGCAAGCTGG + Intronic
954219357 3:49143583-49143605 CTGTGGGGGTCACAGGCAGCAGG + Intergenic
954433559 3:50484174-50484196 ATGTGGGTGTGAGAGAAAGCGGG - Intronic
954875544 3:53800709-53800731 CTGGGGGACTGACAGCCAGCTGG - Intronic
956463923 3:69500151-69500173 CTGTGGTTTGGACAGAGAGCAGG + Intronic
956591506 3:70920223-70920245 CTGTGGGCCTCAAAGACAGATGG + Intergenic
956625068 3:71258900-71258922 CTGTGGGAGTCCCAGACAGCCGG + Intronic
957575180 3:81998150-81998172 CAGTGTTTCTGACAGACAACTGG + Intergenic
961243673 3:125433699-125433721 CTCTGGGTCACACAGACAGATGG - Intergenic
965361905 3:167752064-167752086 CTCAGGGTCTGGCAGAAAGCAGG - Intronic
969537290 4:7764295-7764317 CTGTGGGACACACAGACAGGAGG + Intronic
969844103 4:9905894-9905916 CTCTGGGTCACACAGTCAGCTGG - Intronic
973295542 4:48515999-48516021 CTGTGGGGCTGCCACACAGCAGG + Intronic
977672793 4:99715480-99715502 CTGCAGGTCTGACTTACAGCAGG + Intergenic
978431402 4:108636745-108636767 CTGGGCTTCTGGCAGACAGCAGG + Intergenic
981048081 4:140284052-140284074 CTGTGTGTGTGAGAGAGAGCAGG + Intronic
981727793 4:147866041-147866063 CTGGGGCTCTGACACCCAGCAGG - Intronic
983641641 4:169948921-169948943 CTGTGGGTCATGCAGACAGCTGG - Intergenic
984623823 4:181982713-181982735 CTGTGGGTTTCACAGAAAGGAGG + Intergenic
985599498 5:819309-819331 CTGTGGGTGAGAGAGACAGACGG - Intronic
985608299 5:871100-871122 GTGTGTCTCTGACAGTCAGCAGG - Intronic
993480385 5:88417296-88417318 CTGTGTGTCTGACACACAGTAGG + Intergenic
993764684 5:91841576-91841598 CTGTGGTTCTGAGAGTCACCAGG + Intergenic
995375799 5:111472859-111472881 GTGTGGGTCTGACAGTGTGCAGG - Intronic
997101438 5:130973572-130973594 GTGTGTGTCTGAGAGACAGAGGG + Intergenic
997657610 5:135566990-135567012 CTGTTGGTCTGACTGCCAGACGG - Intergenic
1000753573 5:165128438-165128460 CAGTGGGGCTGAGAGAGAGCAGG + Intergenic
1002435604 5:179229069-179229091 CTGAGGGTCTGACGGAGAGAGGG - Intronic
1002772011 6:298051-298073 CTGCAGGACTGACAGACAGATGG + Intronic
1003844480 6:10158836-10158858 CTGTGGGTCTGACAGGCACTGGG - Intronic
1003980528 6:11385638-11385660 CAGGGGACCTGACAGACAGCAGG - Intergenic
1004320989 6:14631296-14631318 CTGTGGGTCAGGCATTCAGCAGG + Intergenic
1004902432 6:20206579-20206601 CTGAGTGCATGACAGACAGCAGG + Intronic
1006431625 6:34000703-34000725 CTGAGGGTGTGACAGTCAGGAGG + Intergenic
1006463472 6:34177349-34177371 CTGTGTGGCTGCCACACAGCAGG - Intergenic
1007663000 6:43497817-43497839 CTGTAGCACTGACAGACAGGCGG + Intronic
1007747751 6:44053519-44053541 ATCTGGGTCTGAAAGAGAGCAGG - Intergenic
1007901760 6:45420152-45420174 CTGAGGGTCTGCCAGACCGCGGG - Intronic
1008880493 6:56376304-56376326 CTGTGGGTTTCACAGTAAGCTGG - Intronic
1009469749 6:64017668-64017690 CTGTGGGTAGAGCAGACAGCAGG - Intronic
1011798515 6:90983358-90983380 CTGTGGGAGAGAAAGACAGCAGG - Intergenic
1014264611 6:119262099-119262121 CTGTGGGTTTTATAGACAGCCGG - Intronic
1014370090 6:120595508-120595530 CTGTGGGTCAGACACTCTGCGGG + Intergenic
1016638762 6:146324579-146324601 CTGTGGGTTGCAAAGACAGCAGG + Intronic
1018230258 6:161668827-161668849 ATGTGGGTGAGATAGACAGCTGG - Intronic
1018804436 6:167248083-167248105 CTCTGGGTCGGACACACGGCTGG - Intergenic
1018947135 6:168355886-168355908 CTGCGTGTTGGACAGACAGCAGG + Intergenic
1019006265 6:168799230-168799252 CTGGGGGATTGACAGGCAGCTGG - Intergenic
1020543583 7:9493667-9493689 CTAGTGGGCTGACAGACAGCAGG + Intergenic
1024709634 7:52000939-52000961 CTGTGGTTGTAACAGACATCTGG + Intergenic
1026019971 7:66698781-66698803 CCGTGGGTCTGACACAAAGCTGG - Intronic
1026474554 7:70723538-70723560 TTTTGAGTCAGACAGACAGCAGG + Intronic
1032469354 7:132167036-132167058 CTGGGGGACAGGCAGACAGCAGG + Intronic
1032639065 7:133744706-133744728 CTGGAGGTTTTACAGACAGCAGG - Intronic
1032792747 7:135254382-135254404 CTGTGTGTCTGTAGGACAGCTGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034540520 7:151755201-151755223 CTGTGGGTGTGACAGACAGATGG - Intronic
1034966685 7:155395683-155395705 CTGCGGGGCCGACAAACAGCAGG + Exonic
1035267839 7:157701776-157701798 CTGTGGGTTTGTAAGAGAGCCGG + Intronic
1035267855 7:157701874-157701896 CTGTGGGTTTGTAAGAGAGCCGG + Intronic
1035267871 7:157701972-157701994 CTGTGGGTTTGTAAGAGAGCCGG + Intronic
1035267903 7:157702168-157702190 CTGTGGGTTTGTAAGAGAGCCGG + Intronic
1035555193 8:562551-562573 CAGGGGGTCTCACAGAGAGCTGG + Intergenic
1036257686 8:7218668-7218690 CTGTGGGTCAGACACACACTGGG + Intergenic
1036258937 8:7225667-7225689 CTGTGGGTCAGACACACACTGGG + Intergenic
1036307684 8:7613843-7613865 CTGTGGGTCAGACACACACTGGG - Intergenic
1036310990 8:7684263-7684285 CTGTGGGTCAGACACACACTGGG + Intergenic
1036746184 8:11411783-11411805 CTGTGGCTCTGACAGGGAGTAGG + Intronic
1036892421 8:12605108-12605130 CTGTGGGTCAGACACACACTGGG + Intergenic
1038514057 8:28169345-28169367 CTGTGGGTCAGAAATTCAGCAGG + Intronic
1041106204 8:54446401-54446423 GTGTGGGTGTGGCTGACAGCAGG + Intergenic
1041169193 8:55123723-55123745 CTGTGGGACACACACACAGCAGG - Intronic
1042192044 8:66196905-66196927 CAGTTGGACTGACAGGCAGCAGG - Intergenic
1045002779 8:97892964-97892986 CGCTGGGTCTGCCAGACAGGTGG + Intronic
1047944033 8:129857015-129857037 CTGTGTGTCTGTCAGATACCAGG + Intronic
1050318778 9:4429713-4429735 CTCTGTGTCTGACACAGAGCTGG - Intergenic
1052707556 9:32011120-32011142 CTGTGGGACTGGCAGCCAGCTGG - Intergenic
1053568634 9:39280127-39280149 CTGTGCCTCTGAGAGACAGCAGG - Intronic
1053834602 9:42121158-42121180 CTGTGCCTCTGAGAGACAGCAGG - Intronic
1054128511 9:61338880-61338902 CTGTGCCTCTGAGAGACAGCAGG + Intergenic
1054595938 9:67066373-67066395 CTGTGCCTCTGAGAGACAGCAGG + Intergenic
1059483901 9:114612437-114612459 CAGAAGGTCAGACAGACAGCAGG - Intronic
1060222188 9:121770405-121770427 CAGTGGCTCTGACTGGCAGCAGG + Intronic
1061147471 9:128808332-128808354 CTGTGGGTGAGACAGACGGCAGG - Exonic
1061856699 9:133445454-133445476 CTGTGGGCCTGGCCGAGAGCTGG - Intronic
1062350411 9:136135975-136135997 CTGTAGTTCTGACAGCCAGGCGG - Intergenic
1062536961 9:137025338-137025360 CTGTGGGTCTCAGAGAGGGCTGG - Intronic
1062582504 9:137234765-137234787 CTGTGGGGCTGAGAGGAAGCTGG - Intronic
1185803709 X:3037549-3037571 CTGTGGTTTTGCCAGAGAGCTGG + Intergenic
1195831622 X:109065709-109065731 CTGGGGGTCTGTCAGAGAGTGGG + Intergenic
1198310838 X:135424948-135424970 CTGGGGGTCTGTCAGCCTGCTGG + Intergenic
1201236699 Y:11918903-11918925 CTGGGGGACTCACAAACAGCAGG + Intergenic
1202246997 Y:22830196-22830218 CTGTGCCTCAGACAGGCAGCTGG - Intergenic
1202399986 Y:24463944-24463966 CTGTGCCTCAGACAGGCAGCTGG - Intergenic
1202470795 Y:25206142-25206164 CTGTGCCTCAGACAGGCAGCTGG + Intergenic