ID: 1165300107

View in Genome Browser
Species Human (GRCh38)
Location 19:34963454-34963476
Sequence TAGGATCCTGAATCAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165300107_1165300119 22 Left 1165300107 19:34963454-34963476 CCCTGCCCTGATTCAGGATCCTA 0: 1
1: 0
2: 3
3: 8
4: 153
Right 1165300119 19:34963499-34963521 GGTCCCCTGACTCAAAAGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 146
1165300107_1165300123 28 Left 1165300107 19:34963454-34963476 CCCTGCCCTGATTCAGGATCCTA 0: 1
1: 0
2: 3
3: 8
4: 153
Right 1165300123 19:34963505-34963527 CTGACTCAAAAGCAAGGAAATGG 0: 1
1: 0
2: 1
3: 59
4: 578
1165300107_1165300124 29 Left 1165300107 19:34963454-34963476 CCCTGCCCTGATTCAGGATCCTA 0: 1
1: 0
2: 3
3: 8
4: 153
Right 1165300124 19:34963506-34963528 TGACTCAAAAGCAAGGAAATGGG 0: 1
1: 0
2: 4
3: 37
4: 379
1165300107_1165300115 1 Left 1165300107 19:34963454-34963476 CCCTGCCCTGATTCAGGATCCTA 0: 1
1: 0
2: 3
3: 8
4: 153
Right 1165300115 19:34963478-34963500 CTGGGAGCAACTCCCTTCCAGGG 0: 1
1: 0
2: 9
3: 17
4: 184
1165300107_1165300114 0 Left 1165300107 19:34963454-34963476 CCCTGCCCTGATTCAGGATCCTA 0: 1
1: 0
2: 3
3: 8
4: 153
Right 1165300114 19:34963477-34963499 GCTGGGAGCAACTCCCTTCCAGG 0: 1
1: 0
2: 1
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165300107 Original CRISPR TAGGATCCTGAATCAGGGCA GGG (reversed) Intronic
906635146 1:47404630-47404652 TTGGCTCATAAATCAGGGCAAGG - Intergenic
907340062 1:53728563-53728585 TAGGGTGCTGATTGAGGGCATGG - Intronic
907399722 1:54217424-54217446 CAGGATACTGACTCAGGGCTGGG + Intronic
907593268 1:55696280-55696302 TATGATCGTGAATCAGGCCTGGG + Intergenic
909510169 1:76443608-76443630 TAGGATTCTTGATGAGGGCAAGG - Intronic
910158707 1:84250523-84250545 TAGGAATCTGAATCAAGGAAAGG - Intergenic
911015768 1:93330377-93330399 TAGGACCCTGAATGACTGCATGG + Intergenic
911516386 1:98873100-98873122 TAGGATCCTGGAGCAGAACAAGG - Intergenic
923095497 1:230772200-230772222 CAGGATCCTGAGTCAGAGCCCGG - Intronic
924928529 1:248706559-248706581 TTGGATCCTGAGACAGAGCAGGG - Intergenic
1064691335 10:17921774-17921796 TAGAATCCTCAATCAGGGACAGG - Intergenic
1067274374 10:44820987-44821009 TTGGATCCTGGATCAGGAAAGGG + Intergenic
1068142771 10:53027770-53027792 TAGGATACTGACTCAGATCATGG - Intergenic
1070311658 10:75277798-75277820 TAAGATATGGAATCAGGGCAGGG - Intergenic
1070718700 10:78741369-78741391 GAGGATCTAGAGTCAGGGCATGG + Intergenic
1072057958 10:91779320-91779342 TAGGTTCCTGAATGACTGCATGG + Intergenic
1073759943 10:106618502-106618524 TATCATCCTGATTCAGGGCTGGG + Intronic
1076203835 10:128579142-128579164 CATGCTCCTGATTCAGGGCAAGG - Intergenic
1079133874 11:17765078-17765100 GAGGATTCTGAGGCAGGGCAGGG - Intronic
1081428290 11:42949603-42949625 TAGGATACCCAATCAGGTCATGG - Intergenic
1083928807 11:65827057-65827079 TGGGATCCTGAATGGGGGTAGGG - Intronic
1084923259 11:72490096-72490118 TGGGATCCTGAAACAGGAAAAGG + Intergenic
1086502020 11:87463541-87463563 TGGGAAACTGAATCTGGGCATGG + Intergenic
1087857251 11:103107283-103107305 TAGGATCCTGAATCACAGAGTGG - Intergenic
1089199108 11:116712753-116712775 TAGGTTCCAGGATTAGGGCATGG - Intergenic
1089384003 11:118056279-118056301 TGGGAGCCTGACCCAGGGCAAGG + Intergenic
1089955943 11:122571266-122571288 CAGCAACCTGAATCAGGGTATGG - Intergenic
1091857834 12:3753323-3753345 TGGGAGCCTGAATCGGGGCAAGG - Intronic
1093660862 12:21754913-21754935 CAGGATTTTGAATCATGGCAAGG + Intronic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1094503382 12:31039562-31039584 TAGGATACTGGGTTAGGGCAAGG + Intergenic
1094720825 12:33062181-33062203 TGGGATCCTGAATCAGGAAAAGG + Intergenic
1095735074 12:45547520-45547542 TAGGATCCTGAAATATGGGATGG - Intergenic
1095929685 12:47613153-47613175 TGGCATCCTGAAGCAGTGCAGGG - Intergenic
1096489122 12:52004147-52004169 GGGGATCCTGAAACAGGGCTGGG + Intergenic
1098134059 12:67383042-67383064 TAAGATGCAGAATCAGGGCCAGG + Intergenic
1101351578 12:103934607-103934629 GAGCATCCTGAATAAAGGCATGG + Intronic
1101810578 12:108104185-108104207 TAGGACTCTGAATCAGGGATGGG + Intergenic
1103584012 12:121937526-121937548 TAGGATCCTCTATCATGGCCTGG - Intronic
1105291255 13:19055180-19055202 TTGGATCCTGGCTCAGGGCAGGG + Intergenic
1106482818 13:30149514-30149536 GAGCATCCTGCAGCAGGGCATGG + Intergenic
1109038178 13:57293702-57293724 CAGGCTCCTGAATTAGGACATGG + Intergenic
1116045105 14:39733891-39733913 TAGGAACCTCTACCAGGGCAAGG - Intergenic
1119574598 14:75707965-75707987 TATGATCCTGGATCAGTGCTGGG - Intronic
1122258814 14:100500308-100500330 TAGGCCACTGAATTAGGGCAGGG - Intronic
1123481989 15:20640691-20640713 GAGCATTCTGAGTCAGGGCAAGG - Intergenic
1123636023 15:22359674-22359696 GAGCATTCTGAGTCAGGGCAAGG + Intergenic
1125571960 15:40726972-40726994 TAGGCTCCAGAAGCAGGACATGG - Intronic
1126978752 15:54217267-54217289 TAGGATTGTGGATAAGGGCAAGG + Intronic
1127174211 15:56336764-56336786 AATTATCCTGAATTAGGGCAAGG + Intronic
1127827245 15:62715536-62715558 TGGGATTCTGAAGCAGGGGAAGG - Intronic
1130321272 15:82844177-82844199 TAGGACCCTGAATGAGTACAAGG + Intronic
1131103100 15:89709293-89709315 TTGGATCCTGAGGCTGGGCAGGG + Intronic
1133917102 16:10119022-10119044 TAGGTCCCTGAATCACTGCATGG + Intronic
1136686234 16:31996371-31996393 CAGGATCCTGCCTCAGGCCAAGG - Intergenic
1136786847 16:32939900-32939922 CAGGATCCTGCCTCAGGCCAAGG - Intergenic
1136882925 16:33913890-33913912 CAGGATCCTGCCTCAGGCCAAGG + Intergenic
1139002181 16:62525474-62525496 TAGAATGCAGAAACAGGGCAGGG - Intergenic
1139951288 16:70672392-70672414 TAGGGTCCTGAATTGGGTCATGG + Intronic
1141089578 16:81121096-81121118 TAGGCTGCTAGATCAGGGCATGG - Intergenic
1203089083 16_KI270728v1_random:1201570-1201592 CAGGATCCTGCCTCAGGCCAAGG - Intergenic
1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG + Intergenic
1143387320 17:6538948-6538970 TGGGATCTGGACTCAGGGCAGGG - Intronic
1143811730 17:9477146-9477168 GAGGAACCTGAAGCTGGGCACGG - Intronic
1144141813 17:12356728-12356750 TGGGACCCTGAATCACTGCATGG - Intergenic
1147147196 17:38492039-38492061 CAGGATCCTGCCTCAGGCCAAGG - Intronic
1150271783 17:63871494-63871516 TTGGAATCTGAATTAGGGCAAGG - Intergenic
1150275333 17:63894391-63894413 TTGGAATCTGAATTAGGGCAAGG - Intergenic
1150277459 17:63909080-63909102 TTGGAATCTGAATTAGGGCAAGG - Intergenic
1152521567 17:80859585-80859607 GAGGAGCCGGCATCAGGGCAAGG + Intronic
1156201584 18:34838729-34838751 CTGTATCCTGAAACAGGGCAGGG - Intronic
1157491539 18:48127218-48127240 TAGGCTCTGGAATCAGGGCCTGG - Intronic
1157566718 18:48683484-48683506 TTGGATCCAGAAGGAGGGCAAGG - Intronic
1158208003 18:55015071-55015093 TGGGCTCCTCAATCAGGGTAGGG + Intergenic
1158327423 18:56326584-56326606 TTGGATCCTCAGTCAGGGCAGGG - Intergenic
1158519519 18:58159577-58159599 TAGGATCCTGTCTCAGGACTGGG + Intronic
1160749254 19:726271-726293 TAGGACCTGGAACCAGGGCATGG + Intronic
1161129972 19:2582120-2582142 TGGGATCCTGGATCAGATCATGG + Intronic
1161462628 19:4407655-4407677 TAGGATGTTGAAGCGGGGCATGG + Intronic
1162494409 19:11015294-11015316 TGGGATCCTGGACCAGAGCAAGG - Intronic
1162546723 19:11335369-11335391 TTGGACCCTGAATCAGAGGATGG + Intronic
1165300107 19:34963454-34963476 TAGGATCCTGAATCAGGGCAGGG - Intronic
1166453884 19:42923961-42923983 TACGACCCTGAAGCAGGGGAAGG + Intronic
1166672839 19:44721986-44722008 TTAGAACCTGAATCAGGGCCGGG - Intergenic
1168700992 19:58439582-58439604 TACCATCCTGAATCCAGGCAAGG - Intronic
927229302 2:20804200-20804222 TAGGATGTTCAATCTGGGCAGGG - Intronic
927272252 2:21224374-21224396 TAGGTTCCTGAATCACCACATGG - Intergenic
927631011 2:24774025-24774047 TAGGATCAAGAGTCAGGGAAAGG - Intergenic
934949573 2:98567196-98567218 TGGGAACCTGGATCAGGGCCAGG + Intronic
937091514 2:119209462-119209484 TGGGATCCCGAATAAGGGAAAGG + Intergenic
937985281 2:127635552-127635574 AATGACCCTGAGTCAGGGCAGGG - Intronic
941964277 2:171285207-171285229 TATGATCCTAAGTAAGGGCAGGG + Intergenic
946702939 2:222430955-222430977 TAGTATCCTGGATGAGGTCATGG + Intronic
1171167311 20:22983464-22983486 TAGGATCCTGGAACAGAGAAAGG - Intergenic
1178348173 21:31849993-31850015 CAGGATCCTGACTGAGTGCATGG + Intergenic
1178348346 21:31851257-31851279 GAGGATTCTGAATAAGAGCATGG - Intergenic
1179302355 21:40123994-40124016 TACGCTCCTGAATCATGACAAGG - Intronic
1183079153 22:35445244-35445266 TAGGATTCTGAAACATGCCAGGG - Intergenic
1183523664 22:38310987-38311009 CAGGATGGTGAGTCAGGGCAGGG + Intronic
1184616996 22:45645267-45645289 GAGGATCCTGAATCAAGGTCCGG + Intergenic
1184977833 22:48075731-48075753 GAGGCTACAGAATCAGGGCACGG + Intergenic
1185209850 22:49564730-49564752 TGGGCTCCTGAATCGGGGCCAGG - Intronic
953885841 3:46713973-46713995 TTGAATCCTGAGTCAGGCCAGGG - Intronic
956106194 3:65821295-65821317 TCGGGGCCTGAAACAGGGCAGGG - Intronic
956756567 3:72393757-72393779 TAGGATCCTGAAACAGAAAAAGG - Intronic
960438464 3:117656735-117656757 TGGGATCCTGAATTAGATCATGG - Intergenic
962328785 3:134459208-134459230 TTGGATCCTGAAACAGAGAAAGG - Intergenic
962494982 3:135930242-135930264 AATCATCCTGAATCTGGGCAGGG - Intergenic
964655440 3:159061830-159061852 TAAGATACAGAGTCAGGGCAGGG - Intronic
966788521 3:183642195-183642217 TAAGATCCTGAATCAATGCAGGG - Intronic
969381517 4:6802129-6802151 TAGGGTCCAGACTCAGGGAATGG + Intronic
969927798 4:10601471-10601493 TAGGATTCAGATTTAGGGCAGGG - Intronic
970835164 4:20395402-20395424 CAGGAACCTGATTGAGGGCATGG + Intronic
971251120 4:24974294-24974316 TAGGGTTCTGACTCAGGGCGGGG - Intronic
972095162 4:35339967-35339989 TAGGACCCTGAAACTTGGCAAGG + Intergenic
977061977 4:92271100-92271122 GCTGTTCCTGAATCAGGGCATGG + Intergenic
978956727 4:114623240-114623262 TCAGACCCTGGATCAGGGCATGG - Exonic
979854410 4:125613200-125613222 TAGGGTCCTGAGTCCAGGCAGGG - Intergenic
980771340 4:137377583-137377605 TAAGGTCCTGAATAAGTGCATGG - Intergenic
981500963 4:145451141-145451163 TAGGATCCTGAAACAGCGAAAGG + Intergenic
984412127 4:179408153-179408175 TAGTTTCCTGACTCGGGGCATGG - Intergenic
988207436 5:28158162-28158184 TAGAAGCCTGAATTAAGGCAAGG + Intergenic
988811675 5:34791604-34791626 TAGGACCCTGAATGACAGCAGGG - Intronic
990674982 5:58173928-58173950 TAGGATCGTGGATCAGGGCTGGG - Intergenic
998154450 5:139776434-139776456 TAGGATCCTGCAGCAAGGCAGGG + Intergenic
998678222 5:144434414-144434436 GAGGATCCTGAATGAGGGAGGGG + Intronic
999202635 5:149826930-149826952 TAGGTTTCTGGTTCAGGGCATGG + Intronic
1001879907 5:175234361-175234383 TAGGATCCTGAAGGTGGGAAGGG - Intergenic
1004399306 6:15273793-15273815 TAGGATCCTGACTCAAAGCCAGG - Intronic
1005610272 6:27517329-27517351 TAGGATCCTGGAACAGAGAAAGG - Intergenic
1008181813 6:48340563-48340585 GAGAATCCTGAATCATGGCTGGG + Intergenic
1011335879 6:86259273-86259295 TAGGAGCTGGAATCTGGGCAGGG + Intergenic
1013662239 6:112309408-112309430 TGGGATCCTGAACTAGGGCGTGG - Intergenic
1015725927 6:136299791-136299813 TAGGGCCCTGAATCACTGCATGG - Intergenic
1016343285 6:143084844-143084866 TAGGATGCAGAATCAGAACATGG - Intronic
1018461343 6:164002225-164002247 AAGGATCCTGAAGGAGGGTAGGG + Intergenic
1018834032 6:167470174-167470196 TAGGATCCTGAGTCAGAGCAGGG + Intergenic
1020769092 7:12365182-12365204 TTAGATCCTGAATCAGGAAAAGG + Intronic
1020988866 7:15170754-15170776 TAGGATCCTGGAACAGGAAAAGG - Intergenic
1022027562 7:26463048-26463070 CAGGATGCTGATTCAGGTCACGG - Intergenic
1022077889 7:26991609-26991631 TTGGATCCTGAAGCCAGGCATGG + Intronic
1024573171 7:50742424-50742446 TAGGATCCTGGTTAAGAGCATGG - Intronic
1026182119 7:68050791-68050813 CAGAATCCTGAATCAGGCGACGG + Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029306958 7:99626579-99626601 TAGGATCCTGGCTAAGGGCCTGG + Intronic
1032070467 7:128802600-128802622 TGGGATCCTGAAACAGGAAAAGG + Intronic
1033213989 7:139481032-139481054 AAGGCTCCTGAAGCTGGGCACGG - Intronic
1034325173 7:150223783-150223805 GAGGATCTTGAATCCAGGCATGG + Intergenic
1034768032 7:153745464-153745486 GAGGATCTTGAATCCAGGCATGG - Intergenic
1036390427 8:8319722-8319744 AAGGATACAGAATCATGGCATGG + Intronic
1041278417 8:56187340-56187362 TTAGGTTCTGAATCAGGGCAAGG - Intronic
1043449318 8:80350501-80350523 TAGGATCATTAATCTGGGCCAGG - Intergenic
1043769869 8:84184599-84184621 AACGATCCTGAAGCAGGGAACGG - Intronic
1047833407 8:128660893-128660915 TATGATCCTGAATTAGGTCCTGG + Intergenic
1048780294 8:137991925-137991947 TAGGATACTGACTCAGATCATGG + Intergenic
1049917346 9:331001-331023 TAGGACCCTGAAGCAAGGAAGGG - Intronic
1050335170 9:4583496-4583518 TATGATGCTGAACCAGGGCTGGG - Intronic
1051396450 9:16626988-16627010 GAGGCGACTGAATCAGGGCATGG + Intronic
1052195323 9:25706152-25706174 TTGGATCCTGGATCAGGAAAAGG + Intergenic
1055991612 9:82112292-82112314 TAGGTGCCTGAATCAAGGAACGG - Intergenic
1058395588 9:104549969-104549991 TATGATTCTGAGTCAGGGTATGG + Intergenic
1186618625 X:11214986-11215008 CTGGGGCCTGAATCAGGGCAAGG + Intronic
1193074976 X:77345960-77345982 TAGGTTCCAGAAACAGGGTAAGG + Intergenic
1197177712 X:123502896-123502918 TAGGACCCTGACACAGGGGATGG + Intergenic
1198526331 X:137504962-137504984 TAGGATCCTGGATCAGGGCCTGG - Intergenic