ID: 1165301977

View in Genome Browser
Species Human (GRCh38)
Location 19:34975922-34975944
Sequence AAACACTGGTGGTGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165301977_1165301989 29 Left 1165301977 19:34975922-34975944 CCCTTCTTCCACCACCAGTGTTT No data
Right 1165301989 19:34975974-34975996 TAATCAGGGAAGAAGGGACGGGG No data
1165301977_1165301985 22 Left 1165301977 19:34975922-34975944 CCCTTCTTCCACCACCAGTGTTT No data
Right 1165301985 19:34975967-34975989 ATTAAATTAATCAGGGAAGAAGG No data
1165301977_1165301988 28 Left 1165301977 19:34975922-34975944 CCCTTCTTCCACCACCAGTGTTT No data
Right 1165301988 19:34975973-34975995 TTAATCAGGGAAGAAGGGACGGG No data
1165301977_1165301987 27 Left 1165301977 19:34975922-34975944 CCCTTCTTCCACCACCAGTGTTT No data
Right 1165301987 19:34975972-34975994 ATTAATCAGGGAAGAAGGGACGG No data
1165301977_1165301983 14 Left 1165301977 19:34975922-34975944 CCCTTCTTCCACCACCAGTGTTT No data
Right 1165301983 19:34975959-34975981 TTCACTTTATTAAATTAATCAGG No data
1165301977_1165301986 23 Left 1165301977 19:34975922-34975944 CCCTTCTTCCACCACCAGTGTTT No data
Right 1165301986 19:34975968-34975990 TTAAATTAATCAGGGAAGAAGGG No data
1165301977_1165301984 15 Left 1165301977 19:34975922-34975944 CCCTTCTTCCACCACCAGTGTTT No data
Right 1165301984 19:34975960-34975982 TCACTTTATTAAATTAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165301977 Original CRISPR AAACACTGGTGGTGGAAGAA GGG (reversed) Intergenic