ID: 1165301978

View in Genome Browser
Species Human (GRCh38)
Location 19:34975923-34975945
Sequence GAAACACTGGTGGTGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 290}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165301978_1165301988 27 Left 1165301978 19:34975923-34975945 CCTTCTTCCACCACCAGTGTTTC 0: 1
1: 0
2: 2
3: 31
4: 290
Right 1165301988 19:34975973-34975995 TTAATCAGGGAAGAAGGGACGGG No data
1165301978_1165301989 28 Left 1165301978 19:34975923-34975945 CCTTCTTCCACCACCAGTGTTTC 0: 1
1: 0
2: 2
3: 31
4: 290
Right 1165301989 19:34975974-34975996 TAATCAGGGAAGAAGGGACGGGG No data
1165301978_1165301983 13 Left 1165301978 19:34975923-34975945 CCTTCTTCCACCACCAGTGTTTC 0: 1
1: 0
2: 2
3: 31
4: 290
Right 1165301983 19:34975959-34975981 TTCACTTTATTAAATTAATCAGG No data
1165301978_1165301986 22 Left 1165301978 19:34975923-34975945 CCTTCTTCCACCACCAGTGTTTC 0: 1
1: 0
2: 2
3: 31
4: 290
Right 1165301986 19:34975968-34975990 TTAAATTAATCAGGGAAGAAGGG No data
1165301978_1165301984 14 Left 1165301978 19:34975923-34975945 CCTTCTTCCACCACCAGTGTTTC 0: 1
1: 0
2: 2
3: 31
4: 290
Right 1165301984 19:34975960-34975982 TCACTTTATTAAATTAATCAGGG No data
1165301978_1165301985 21 Left 1165301978 19:34975923-34975945 CCTTCTTCCACCACCAGTGTTTC 0: 1
1: 0
2: 2
3: 31
4: 290
Right 1165301985 19:34975967-34975989 ATTAAATTAATCAGGGAAGAAGG No data
1165301978_1165301987 26 Left 1165301978 19:34975923-34975945 CCTTCTTCCACCACCAGTGTTTC 0: 1
1: 0
2: 2
3: 31
4: 290
Right 1165301987 19:34975972-34975994 ATTAATCAGGGAAGAAGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165301978 Original CRISPR GAAACACTGGTGGTGGAAGA AGG (reversed) Intergenic