ID: 1165301980

View in Genome Browser
Species Human (GRCh38)
Location 19:34975933-34975955
Sequence GGTTTCAGCAGAAACACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165301980_1165301984 4 Left 1165301980 19:34975933-34975955 CCACCAGTGTTTCTGCTGAAACC No data
Right 1165301984 19:34975960-34975982 TCACTTTATTAAATTAATCAGGG No data
1165301980_1165301989 18 Left 1165301980 19:34975933-34975955 CCACCAGTGTTTCTGCTGAAACC No data
Right 1165301989 19:34975974-34975996 TAATCAGGGAAGAAGGGACGGGG No data
1165301980_1165301987 16 Left 1165301980 19:34975933-34975955 CCACCAGTGTTTCTGCTGAAACC No data
Right 1165301987 19:34975972-34975994 ATTAATCAGGGAAGAAGGGACGG No data
1165301980_1165301983 3 Left 1165301980 19:34975933-34975955 CCACCAGTGTTTCTGCTGAAACC No data
Right 1165301983 19:34975959-34975981 TTCACTTTATTAAATTAATCAGG No data
1165301980_1165301986 12 Left 1165301980 19:34975933-34975955 CCACCAGTGTTTCTGCTGAAACC No data
Right 1165301986 19:34975968-34975990 TTAAATTAATCAGGGAAGAAGGG No data
1165301980_1165301985 11 Left 1165301980 19:34975933-34975955 CCACCAGTGTTTCTGCTGAAACC No data
Right 1165301985 19:34975967-34975989 ATTAAATTAATCAGGGAAGAAGG No data
1165301980_1165301988 17 Left 1165301980 19:34975933-34975955 CCACCAGTGTTTCTGCTGAAACC No data
Right 1165301988 19:34975973-34975995 TTAATCAGGGAAGAAGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165301980 Original CRISPR GGTTTCAGCAGAAACACTGG TGG (reversed) Intergenic
No off target data available for this crispr