ID: 1165301982

View in Genome Browser
Species Human (GRCh38)
Location 19:34975954-34975976
Sequence TTAATTTAATAAAGTGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165301982_1165301988 -4 Left 1165301982 19:34975954-34975976 CCATATTCACTTTATTAAATTAA No data
Right 1165301988 19:34975973-34975995 TTAATCAGGGAAGAAGGGACGGG No data
1165301982_1165301985 -10 Left 1165301982 19:34975954-34975976 CCATATTCACTTTATTAAATTAA No data
Right 1165301985 19:34975967-34975989 ATTAAATTAATCAGGGAAGAAGG No data
1165301982_1165301986 -9 Left 1165301982 19:34975954-34975976 CCATATTCACTTTATTAAATTAA No data
Right 1165301986 19:34975968-34975990 TTAAATTAATCAGGGAAGAAGGG No data
1165301982_1165301987 -5 Left 1165301982 19:34975954-34975976 CCATATTCACTTTATTAAATTAA No data
Right 1165301987 19:34975972-34975994 ATTAATCAGGGAAGAAGGGACGG No data
1165301982_1165301989 -3 Left 1165301982 19:34975954-34975976 CCATATTCACTTTATTAAATTAA No data
Right 1165301989 19:34975974-34975996 TAATCAGGGAAGAAGGGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165301982 Original CRISPR TTAATTTAATAAAGTGAATA TGG (reversed) Intergenic
No off target data available for this crispr