ID: 1165301987

View in Genome Browser
Species Human (GRCh38)
Location 19:34975972-34975994
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165301982_1165301987 -5 Left 1165301982 19:34975954-34975976 CCATATTCACTTTATTAAATTAA No data
Right 1165301987 19:34975972-34975994 ATTAATCAGGGAAGAAGGGACGG No data
1165301978_1165301987 26 Left 1165301978 19:34975923-34975945 CCTTCTTCCACCACCAGTGTTTC 0: 1
1: 0
2: 2
3: 31
4: 290
Right 1165301987 19:34975972-34975994 ATTAATCAGGGAAGAAGGGACGG No data
1165301980_1165301987 16 Left 1165301980 19:34975933-34975955 CCACCAGTGTTTCTGCTGAAACC No data
Right 1165301987 19:34975972-34975994 ATTAATCAGGGAAGAAGGGACGG No data
1165301977_1165301987 27 Left 1165301977 19:34975922-34975944 CCCTTCTTCCACCACCAGTGTTT No data
Right 1165301987 19:34975972-34975994 ATTAATCAGGGAAGAAGGGACGG No data
1165301979_1165301987 19 Left 1165301979 19:34975930-34975952 CCACCACCAGTGTTTCTGCTGAA No data
Right 1165301987 19:34975972-34975994 ATTAATCAGGGAAGAAGGGACGG No data
1165301981_1165301987 13 Left 1165301981 19:34975936-34975958 CCAGTGTTTCTGCTGAAACCATA No data
Right 1165301987 19:34975972-34975994 ATTAATCAGGGAAGAAGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165301987 Original CRISPR ATTAATCAGGGAAGAAGGGA CGG Intergenic