ID: 1165301989

View in Genome Browser
Species Human (GRCh38)
Location 19:34975974-34975996
Sequence TAATCAGGGAAGAAGGGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165301977_1165301989 29 Left 1165301977 19:34975922-34975944 CCCTTCTTCCACCACCAGTGTTT No data
Right 1165301989 19:34975974-34975996 TAATCAGGGAAGAAGGGACGGGG No data
1165301979_1165301989 21 Left 1165301979 19:34975930-34975952 CCACCACCAGTGTTTCTGCTGAA No data
Right 1165301989 19:34975974-34975996 TAATCAGGGAAGAAGGGACGGGG No data
1165301978_1165301989 28 Left 1165301978 19:34975923-34975945 CCTTCTTCCACCACCAGTGTTTC No data
Right 1165301989 19:34975974-34975996 TAATCAGGGAAGAAGGGACGGGG No data
1165301980_1165301989 18 Left 1165301980 19:34975933-34975955 CCACCAGTGTTTCTGCTGAAACC No data
Right 1165301989 19:34975974-34975996 TAATCAGGGAAGAAGGGACGGGG No data
1165301982_1165301989 -3 Left 1165301982 19:34975954-34975976 CCATATTCACTTTATTAAATTAA No data
Right 1165301989 19:34975974-34975996 TAATCAGGGAAGAAGGGACGGGG No data
1165301981_1165301989 15 Left 1165301981 19:34975936-34975958 CCAGTGTTTCTGCTGAAACCATA No data
Right 1165301989 19:34975974-34975996 TAATCAGGGAAGAAGGGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165301989 Original CRISPR TAATCAGGGAAGAAGGGACG GGG Intergenic
No off target data available for this crispr