ID: 1165302498

View in Genome Browser
Species Human (GRCh38)
Location 19:34979615-34979637
Sequence CAGTGATAGGGGAATGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165302498_1165302505 12 Left 1165302498 19:34979615-34979637 CCAGTTGCATTCCCCTATCACTG No data
Right 1165302505 19:34979650-34979672 GTGTGTGGAAGAGCAGACCCTGG No data
1165302498_1165302502 -10 Left 1165302498 19:34979615-34979637 CCAGTTGCATTCCCCTATCACTG No data
Right 1165302502 19:34979628-34979650 CCTATCACTGCCTCAACTTTAGG No data
1165302498_1165302506 15 Left 1165302498 19:34979615-34979637 CCAGTTGCATTCCCCTATCACTG No data
Right 1165302506 19:34979653-34979675 TGTGGAAGAGCAGACCCTGGTGG No data
1165302498_1165302503 -3 Left 1165302498 19:34979615-34979637 CCAGTTGCATTCCCCTATCACTG No data
Right 1165302503 19:34979635-34979657 CTGCCTCAACTTTAGGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165302498 Original CRISPR CAGTGATAGGGGAATGCAAC TGG (reversed) Intergenic
No off target data available for this crispr