ID: 1165306408

View in Genome Browser
Species Human (GRCh38)
Location 19:35005438-35005460
Sequence CACCGACCAAGGCGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165306396_1165306408 29 Left 1165306396 19:35005386-35005408 CCCTGTGGATGTGGATGTGGATG 0: 1
1: 0
2: 0
3: 36
4: 506
Right 1165306408 19:35005438-35005460 CACCGACCAAGGCGGGAGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 114
1165306397_1165306408 28 Left 1165306397 19:35005387-35005409 CCTGTGGATGTGGATGTGGATGT 0: 1
1: 0
2: 3
3: 31
4: 303
Right 1165306408 19:35005438-35005460 CACCGACCAAGGCGGGAGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165306408 Original CRISPR CACCGACCAAGGCGGGAGCT GGG Intronic
900399024 1:2465380-2465402 CTCCGGCCAAGGCAGAAGCTGGG + Intronic
900531408 1:3155230-3155252 CACCGGCCAAGGCAGGCGGTGGG + Intronic
900604810 1:3519191-3519213 CACCCAGAAAGGCGGGCGCTGGG - Intronic
900921137 1:5671354-5671376 CAGGGACCATGGAGGGAGCTAGG - Intergenic
901646169 1:10717941-10717963 CAGCGACCAAAGCGGGTGCAGGG + Intronic
902045281 1:13519290-13519312 CACCAACCATGCCAGGAGCTGGG - Intergenic
904375810 1:30081783-30081805 CACCAACCAAGCCTGGAGTTAGG + Intergenic
906608203 1:47185408-47185430 CACTGCCCAAGGCACGAGCTGGG - Intronic
915484805 1:156212883-156212905 CACCGAGCAGGGCGGGGGCGGGG - Intergenic
921383880 1:214551155-214551177 CCCCGTCCAAGCCGGGAGTTGGG - Intronic
1063987268 10:11518231-11518253 CACAGACTGAGGTGGGAGCTGGG + Intronic
1065956988 10:30702605-30702627 CACTGACCAAGACGGCAGATGGG - Intergenic
1077353509 11:2104013-2104035 CTGCGACCATGGCTGGAGCTGGG - Intergenic
1077507835 11:2940362-2940384 CACTGAGCAAGGCGGGTGCAGGG - Intergenic
1081870139 11:46379620-46379642 CAAGGTCCTAGGCGGGAGCTGGG + Intronic
1089981966 11:122780046-122780068 CACCTACATGGGCGGGAGCTTGG - Intronic
1104730870 12:131104656-131104678 CACCGACAGAGGCCGGTGCTGGG - Intronic
1112282734 13:98076683-98076705 GGCTGGCCAAGGCGGGAGCTTGG - Intergenic
1114325901 14:21588362-21588384 CAGCGACAAAGGCAGGAGGTGGG + Intergenic
1114481014 14:23034570-23034592 CACCAACCCAGGCGGAGGCTGGG - Intronic
1115548930 14:34487986-34488008 CAGGGACCAAGGCAGGAACTTGG - Intergenic
1123165330 14:106320265-106320287 CACCAACCAGGGCAGGAGCCTGG + Intergenic
1127312315 15:57763363-57763385 CACAGACCAAGACGGGCGCAGGG - Intronic
1133156330 16:3879723-3879745 TACCGATCGAGCCGGGAGCTCGG - Intronic
1134666595 16:16023475-16023497 CACCCACCAAGGCCTGATCTTGG + Intronic
1137619758 16:49868497-49868519 CACGGGCCACTGCGGGAGCTTGG - Intergenic
1141143776 16:81514908-81514930 CACAGACCAAGTGGGGCGCTGGG + Intronic
1146475272 17:33157669-33157691 CTCAGACCAAGGTGGGAGCAGGG - Intronic
1147260373 17:39206627-39206649 CACACACCAAGCTGGGAGCTTGG - Intergenic
1148750162 17:49940981-49941003 CAGCTACCATGTCGGGAGCTTGG - Intergenic
1150270658 17:63862380-63862402 TACACACCAAGGCTGGAGCTGGG - Intergenic
1150274284 17:63885901-63885923 TACACACCAAGGCTGGAGCTGGG - Intergenic
1150276429 17:63900729-63900751 TACACACCAAGGCTGGAGCTGGG - Intergenic
1153815293 18:8785508-8785530 CACAGTCCAGGGCGGCAGCTGGG - Intronic
1161260803 19:3336831-3336853 CACAGAGCAAGGAGGGAGCAGGG + Intergenic
1161317139 19:3622597-3622619 CACCGGCCATGACTGGAGCTGGG + Intronic
1165306408 19:35005438-35005460 CACCGACCAAGGCGGGAGCTGGG + Intronic
1167077728 19:47259425-47259447 CAGAGACCAAGGAGGAAGCTGGG + Intronic
1167622771 19:50568363-50568385 CACCGTCCGAGGCGGGGGCCGGG - Intergenic
1167934765 19:52897182-52897204 CACCGCACAAGGAGGGAGGTGGG + Intronic
932327615 2:70873476-70873498 GACCGACCAAGGCAGGAGGATGG - Intergenic
941411319 2:165160366-165160388 CACCGACCAAGGGTGGTGGTGGG - Intronic
942812371 2:180014185-180014207 CCCCGACCAAGGTTGGAGGTGGG + Intergenic
946339097 2:219057065-219057087 CACAGAACAAGGCGGGTGGTGGG - Intronic
1168791348 20:578417-578439 CACCCAGCAAGTAGGGAGCTAGG - Intergenic
1174572061 20:51508956-51508978 CTCTGAGCGAGGCGGGAGCTGGG - Intronic
1176597353 21:8759270-8759292 CACGGACCCAGGCGGAGGCTGGG + Intergenic
1176667988 21:9705380-9705402 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1176667995 21:9705416-9705438 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1176668002 21:9705452-9705474 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1176668009 21:9705488-9705510 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1176668016 21:9705524-9705546 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1176668023 21:9705560-9705582 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1176668046 21:9705668-9705690 CGCTGACGAAGGCGGGAGCGGGG - Intergenic
1176668055 21:9705704-9705726 CGCTGACGAAGGCGGGAGCGGGG - Intergenic
1176668064 21:9705740-9705762 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1176668071 21:9705776-9705798 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1176668078 21:9705812-9705834 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1176668085 21:9705848-9705870 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1176668092 21:9705884-9705906 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1176668099 21:9705920-9705942 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1176668106 21:9705956-9705978 CGCTGACGAAGGCGGGAGCGCGG - Intergenic
1179457459 21:41508734-41508756 CACCGGCCAGGGCGGGAGTGAGG + Intronic
1180004953 21:45016249-45016271 GAGCCACCAAGGCCGGAGCTGGG - Intergenic
1180336177 22:11578605-11578627 CAGGGACCATGGAGGGAGCTGGG - Intergenic
1181094616 22:20496598-20496620 CACCGACCGCGGAGGGAGCGGGG - Intronic
1181760313 22:25053742-25053764 CACAGACAAAGGGGGGTGCTTGG + Intronic
1182447274 22:30397189-30397211 CACAGCCCGAGGCGGGAGCCCGG - Intronic
1184694712 22:46132998-46133020 CACTGACCATGGCGTGACCTTGG - Intergenic
1185285809 22:49999573-49999595 CACCGAACGGGGCGGGAGCGGGG + Intronic
950628849 3:14267974-14267996 CATCTGCCAAGGTGGGAGCTGGG + Intergenic
954208327 3:49077408-49077430 CACCAAGCAAGGAGGAAGCTAGG + Intronic
954916914 3:54156343-54156365 CACCCACGGAGGAGGGAGCTGGG + Intronic
955978809 3:64503794-64503816 CAACGACCATGGGGTGAGCTTGG + Intergenic
968588566 4:1446308-1446330 AGCCGACCAGGGCTGGAGCTGGG + Intergenic
983079903 4:163372263-163372285 CTCCGACCAAGACCGGAGATAGG - Intergenic
983484529 4:168318323-168318345 CCCCGTCAAAGGTGGGAGCTGGG - Intronic
986258494 5:6122235-6122257 CACCCAACCAGGAGGGAGCTGGG + Intergenic
993054604 5:82967933-82967955 CAAAGACCAAGGAGGGAGGTGGG + Intergenic
994185183 5:96808016-96808038 CCCTGGCTAAGGCGGGAGCTGGG + Exonic
1000246675 5:159453970-159453992 CACCTATCAGGGAGGGAGCTGGG + Intergenic
1001274352 5:170339419-170339441 CCCCAACCAGGGCAGGAGCTGGG - Intergenic
1017083055 6:150686837-150686859 CACCCACCAAGGCAGGACCACGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1018859909 6:167704031-167704053 CAGCGTCCGAGCCGGGAGCTGGG - Intergenic
1019523142 7:1469435-1469457 CACCCAGCAAGGGGGCAGCTGGG - Intergenic
1019928107 7:4206393-4206415 CTGTGACCAAGGGGGGAGCTGGG - Intronic
1022004582 7:26255632-26255654 CACCCACCAAAGTGAGAGCTGGG - Intergenic
1025205603 7:56991935-56991957 CAGAGGGCAAGGCGGGAGCTTGG - Intergenic
1025666337 7:63585003-63585025 CAGAGGGCAAGGCGGGAGCTTGG + Intergenic
1031735196 7:125350894-125350916 CACCGATGAAGGTGGGAGCCTGG - Intergenic
1032095023 7:128933701-128933723 CACCGACAAGGGCAGGAGCCAGG + Intergenic
1032191084 7:129766273-129766295 CACAGCTCAACGCGGGAGCTGGG - Intergenic
1037755965 8:21710218-21710240 CGCAGCCCAAGGCGGGAGGTTGG - Intronic
1040626285 8:49152993-49153015 CTCCGGCAAAGGCGGGAGGTGGG - Intergenic
1057126279 9:92618510-92618532 CCCCGACCAAGGATGCAGCTGGG - Exonic
1203657751 Un_KI270753v1:14963-14985 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1203657758 Un_KI270753v1:14999-15021 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1203657765 Un_KI270753v1:15035-15057 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1203657772 Un_KI270753v1:15071-15093 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1203657779 Un_KI270753v1:15107-15129 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1203657786 Un_KI270753v1:15143-15165 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1203657793 Un_KI270753v1:15179-15201 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1203657800 Un_KI270753v1:15215-15237 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1203657807 Un_KI270753v1:15251-15273 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1203657814 Un_KI270753v1:15287-15309 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1203657823 Un_KI270753v1:15323-15345 CGCTGACGAAGGCGGGAGCGGGG + Intergenic
1203657832 Un_KI270753v1:15359-15381 CGCTGACGAAGGCGGGAGCGGGG + Intergenic
1203657839 Un_KI270753v1:15395-15417 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1203657846 Un_KI270753v1:15431-15453 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1203657853 Un_KI270753v1:15467-15489 CGCTGACGAAGGCGGGAGCGCGG + Intergenic
1187243336 X:17532674-17532696 CCCAGACCAAGGCAGGGGCTAGG + Intronic
1195094027 X:101489083-101489105 CACAGACCAAGGCTAAAGCTTGG + Exonic
1195613167 X:106892053-106892075 CACGGACCAAGGCTGAAGCACGG + Intronic
1196764973 X:119235383-119235405 CCCAGACAAAGGCGGGAGTTTGG - Intergenic