ID: 1165306510

View in Genome Browser
Species Human (GRCh38)
Location 19:35005956-35005978
Sequence TGGGATTCCCTCCACCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165306510_1165306519 12 Left 1165306510 19:35005956-35005978 CCCAGGTGGTGGAGGGAATCCCA 0: 1
1: 0
2: 1
3: 31
4: 222
Right 1165306519 19:35005991-35006013 AATACATCAAGGCCCCTAAATGG 0: 1
1: 0
2: 1
3: 7
4: 103
1165306510_1165306520 13 Left 1165306510 19:35005956-35005978 CCCAGGTGGTGGAGGGAATCCCA 0: 1
1: 0
2: 1
3: 31
4: 222
Right 1165306520 19:35005992-35006014 ATACATCAAGGCCCCTAAATGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1165306510_1165306515 1 Left 1165306510 19:35005956-35005978 CCCAGGTGGTGGAGGGAATCCCA 0: 1
1: 0
2: 1
3: 31
4: 222
Right 1165306515 19:35005980-35006002 CTGCACCCCAGAATACATCAAGG 0: 1
1: 0
2: 1
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165306510 Original CRISPR TGGGATTCCCTCCACCACCT GGG (reversed) Intronic
900177056 1:1295592-1295614 TGGGGTTCCCTGCCCCACCCCGG - Intronic
902937174 1:19772780-19772802 TGACATTGCCTCTACCACCTGGG - Intronic
903386981 1:22933360-22933382 TAGGATTCCTTTCCCCACCTGGG - Intergenic
903797597 1:25941534-25941556 TATGATACCCTGCACCACCTTGG - Intergenic
904954658 1:34272944-34272966 TGGGATTCACTGCACCTCTTGGG + Intergenic
905225848 1:36478724-36478746 TGGCATGCCCTGCACTACCTTGG + Intronic
905344593 1:37302641-37302663 TTGGTTTCCCTCCACCAGGTAGG + Intergenic
905971393 1:42144990-42145012 CTGGATTCCCACCACCTCCTCGG + Intergenic
906203889 1:43976670-43976692 ATGGATTCCCGCCACCACCCTGG - Intronic
908146895 1:61256026-61256048 TTGGCTTCCCTCGACCACATTGG + Intronic
912830521 1:112949123-112949145 TGGGATTACCTCCACCTCTCAGG + Intronic
914764774 1:150628459-150628481 TGAGAGTCCCTGCACCACCAGGG - Intronic
915479106 1:156173058-156173080 AGGGTTTCCCTCCTCAACCTGGG - Intronic
916046119 1:161000969-161000991 TGATAATCCCTCCACAACCTAGG + Intronic
916135314 1:161647536-161647558 GGTGATTCCCCCCACCGCCTCGG + Intronic
916810447 1:168301023-168301045 GAGGATTCCCTCCACCATCCTGG - Intronic
918626718 1:186664159-186664181 TGAGATCACCTCCACCACCTGGG + Intergenic
919302328 1:195786539-195786561 TGGGATCACCTTCAACACCTAGG + Intergenic
919891425 1:201978116-201978138 TGGGATTACCGCCACCACACCGG + Intergenic
920344087 1:205294732-205294754 TGAAATCCCCTCCCCCACCTAGG + Intergenic
922753175 1:228080477-228080499 TGGGCTCCCCACCACCACCGGGG - Intergenic
923108527 1:230872444-230872466 TGGGATGCCCTATACCACCTGGG + Intergenic
923637460 1:235714239-235714261 TGGTATTCCTTCCAGCAGCTGGG + Intronic
923774965 1:236969859-236969881 TGTGACACCCTGCACCACCTAGG - Intergenic
1063216141 10:3927299-3927321 TGGGATTCCCTTCAGCAGCAGGG + Intergenic
1065579594 10:27156941-27156963 TGGGATTCCCGCCACCACACCGG + Intronic
1067284620 10:44898686-44898708 TGGAAGTCCCCCCGCCACCTGGG + Intergenic
1067723218 10:48745814-48745836 TGGGATTCCATCGAACACCTCGG + Intronic
1068771868 10:60830801-60830823 TGTGATGCCCTACATCACCTCGG - Intergenic
1070303999 10:75227247-75227269 TGGGGTTCCCACAACCCCCTGGG - Intronic
1070557304 10:77538681-77538703 TGGCACCCCCTCCCCCACCTTGG + Intronic
1072691395 10:97574358-97574380 TGGAATACCCTCCACCATCCTGG - Intronic
1072754813 10:98012289-98012311 GTGGAATCCCTCCACCTCCTTGG - Intronic
1074693732 10:116029482-116029504 TGGCAGTCCCTCCACCTTCTGGG - Intergenic
1075588261 10:123672738-123672760 TGAGAATCCCTCCTCTACCTCGG - Intronic
1076071489 10:127493478-127493500 TGGGATGCCCTGTGCCACCTCGG + Intergenic
1076173229 10:128340677-128340699 TGGCTTTTCCTCCAGCACCTGGG - Intergenic
1076797538 10:132805571-132805593 GGGGTGCCCCTCCACCACCTGGG + Intergenic
1076872278 10:133199941-133199963 TGGGAGTCTCTTCACCTCCTTGG - Intronic
1078014239 11:7599530-7599552 TGTGATGCCCAGCACCACCTGGG + Intronic
1083864580 11:65446565-65446587 TGGGGCTCCCTCCACCCCATGGG - Intergenic
1084051441 11:66602753-66602775 TCTGATTCCCTGCCCCACCTGGG - Intronic
1087542554 11:99538985-99539007 TGTGATACCCTACTCCACCTGGG - Intronic
1091647586 12:2285444-2285466 TGCCATTTCCTCCACTACCTGGG - Intronic
1093114263 12:15190230-15190252 TTGGCTTCCCTGCACCACATTGG + Intronic
1094649273 12:32359414-32359436 TGTGATGCCCTGCACCACTTTGG - Intronic
1099996900 12:89787882-89787904 TGTGATGCCCTGCACCACTTTGG - Intergenic
1100933242 12:99634334-99634356 TGTGAGGCCCTGCACCACCTTGG + Intronic
1102552926 12:113705246-113705268 TGGGATTCACTCTGTCACCTAGG - Intergenic
1103589231 12:121979457-121979479 TGGGATTCTCTACATCTCCTGGG + Intronic
1105443381 13:20433393-20433415 TGGGTTTTCCTCCACTACATGGG + Intronic
1106112892 13:26792459-26792481 TGGGATGCCCTCCACTAACCTGG + Intergenic
1106161810 13:27207931-27207953 TGTGATGCCGTGCACCACCTTGG + Intergenic
1107161446 13:37233506-37233528 TGTGATACCTTGCACCACCTTGG + Intergenic
1107871598 13:44751436-44751458 TTGGATTCCCTGGACCACATTGG + Intergenic
1109789869 13:67231325-67231347 TGGGACTCCTTCCAGCCCCTCGG - Intergenic
1110573525 13:77030912-77030934 TGGGTCTCCCTCTATCACCTAGG - Intergenic
1110939079 13:81326927-81326949 TCTGATTCCCTTCACCACATTGG + Intergenic
1112179888 13:97068323-97068345 TGGGATTCCCCCTACCAGCGGGG + Intergenic
1113425878 13:110208073-110208095 TGTAATTGCCTCCACCAGCTTGG + Intronic
1113481975 13:110627912-110627934 TGGGGTTCCCTCAGCCTCCTGGG + Intronic
1114994367 14:28329774-28329796 TTGGATTCCTTCCATCATCTTGG + Intergenic
1119617103 14:76106061-76106083 GTGGTTTCCCTCCACCTCCTTGG + Intergenic
1121430434 14:93882582-93882604 TGTGATGCCCTGCACCATCTTGG - Intergenic
1121678982 14:95777011-95777033 GGTGCTTCCCTCGACCACCTGGG + Intergenic
1122608064 14:102961231-102961253 AGGGAATCCCTCCAACAACTGGG + Intronic
1122866554 14:104607633-104607655 ATGGATGCCCTGCACCACCTTGG + Intergenic
1122876042 14:104665888-104665910 TGGGCAACCCTCCACCACCAGGG + Intergenic
1124438331 15:29669399-29669421 TGTGATGCCCGGCACCACCTTGG + Intergenic
1126662576 15:51047306-51047328 CTGGCTTCCCTCCCCCACCTTGG - Intergenic
1128259738 15:66224817-66224839 TGAGATTCACTCCCCCATCTGGG - Intronic
1128316479 15:66662475-66662497 TGGGAGTCTCTCCTCCACCCTGG - Intronic
1128894110 15:71357129-71357151 TTGTATTCTCTCCATCACCTAGG - Intronic
1129451489 15:75653582-75653604 GGGGATCCCCTCCCCCATCTGGG - Intronic
1129868056 15:78924068-78924090 TTGGATCCCCCCCACCTCCTGGG - Intronic
1130863147 15:87908894-87908916 TGGGCTTCCCTCCACGAGCTTGG + Intronic
1130888783 15:88115776-88115798 TGGGATTCCAGCCACCACCTAGG + Intronic
1131086818 15:89582689-89582711 TGGGAATCCCCAGACCACCTTGG + Exonic
1133318302 16:4897638-4897660 TGGGAGTCCCCCCAGCACCGGGG - Intronic
1133681180 16:8121638-8121660 CCGGATTCCCTCCACCTCCTGGG + Intergenic
1134067689 16:11239742-11239764 TGGGATGCCCTGTGCCACCTTGG - Intergenic
1134313867 16:13100379-13100401 TGGGATTCACTCATTCACCTGGG - Intronic
1134860796 16:17558653-17558675 TGGCTTTCCCTCCACCAACCAGG + Intergenic
1136144756 16:28310044-28310066 TGGGAAACCCTCCCCCACCACGG + Intronic
1136395800 16:29991801-29991823 GGGGTCTCCCTCCGCCACCTAGG + Intronic
1136648943 16:31648944-31648966 TGGGATTGCCTCCAATGCCTGGG - Intergenic
1137285459 16:47012594-47012616 TGTGATGCCCTGCGCCACCTTGG - Intergenic
1138030653 16:53557051-53557073 TGGGCTTCCCTGGACCACATTGG + Intergenic
1138493303 16:57390852-57390874 TGTGATACCCTGCCCCACCTTGG + Intergenic
1139808460 16:69590775-69590797 TGGGATTCCCCGCCCCATCTGGG + Intronic
1139882977 16:70189272-70189294 TTAGAATGCCTCCACCACCTGGG - Intergenic
1140369532 16:74406247-74406269 TTAGAATGCCTCCACCACCTGGG + Intergenic
1140530887 16:75664862-75664884 TGTGATACCCTGTACCACCTTGG + Intronic
1142053151 16:87973681-87973703 TCGGCTTACCTCCACCTCCTGGG - Intronic
1143764756 17:9130241-9130263 TGGGTTTCACTCCAGCACCATGG + Intronic
1143981689 17:10875500-10875522 TGGGCCTCTCTCCAGCACCTTGG - Intergenic
1144347820 17:14365893-14365915 TGTGATGCCCTGCACCTCCTTGG - Intergenic
1148480734 17:47958019-47958041 TGGGATTCCCTCCTCCTGCGTGG - Intergenic
1148538829 17:48463485-48463507 TGGGACTCCCTCAGCCACCCAGG - Intergenic
1149387142 17:56153450-56153472 GGGGTTTCCCTCCACCCCCCAGG + Intronic
1153581398 18:6577571-6577593 TGTGATACCCTGCATCACCTGGG - Intronic
1153916846 18:9753409-9753431 TGTGATGCCCTGCTCCACCTTGG + Intronic
1154088342 18:11329641-11329663 TGGGCTGCTCTCCACCTCCTGGG + Intergenic
1155322451 18:24632392-24632414 TGAGATTCCCTCCACCAAAAAGG - Intergenic
1155607710 18:27626288-27626310 TGGGATGCCCTGGACCACCTTGG + Intergenic
1156561652 18:38132437-38132459 TTGGATTCCCTCCTGCACCCAGG + Intergenic
1157287578 18:46387551-46387573 TGTGCTTCCCGGCACCACCTGGG + Intronic
1162313681 19:9923716-9923738 TGGGATTGCCTTTACCTCCTGGG + Intronic
1162915927 19:13874352-13874374 TTGGAATGCCTCCTCCACCTCGG + Intronic
1163447054 19:17353029-17353051 TGGGATGCCCTCCCCCTCCTGGG + Intronic
1163797934 19:19347966-19347988 TGGGATTCCCTCCTCAGCCCTGG + Intronic
1163828917 19:19538549-19538571 TCGGATCCCCGCGACCACCTGGG + Intronic
1163849827 19:19656575-19656597 GGGGATCCCCGCCACCCCCTGGG + Intronic
1164506581 19:28866139-28866161 TGGGATTCCCACCACTCCCTTGG - Intergenic
1165306510 19:35005956-35005978 TGGGATTCCCTCCACCACCTGGG - Intronic
1165635103 19:37334002-37334024 TCGGATCCCCACCACCACCAGGG + Intronic
1168550609 19:57290301-57290323 TGGGTTTCCCTCTGTCACCTAGG + Intronic
1168569242 19:57451366-57451388 TGTGATGCCCTGTACCACCTTGG - Intronic
927240222 2:20914429-20914451 TGGGAATCCCTCCTTCACCAAGG + Intergenic
928109576 2:28495743-28495765 TGGAATTCCGACCAGCACCTGGG + Intronic
928196293 2:29218844-29218866 TGGCTTTCCCACCACCACCTAGG - Intronic
930395720 2:50821357-50821379 TTGGTTTCCCTTCACCACATTGG - Intronic
932364510 2:71140339-71140361 TGTGATGCCCTGCACCACCTTGG - Intronic
932852630 2:75201163-75201185 AGGGAATGCCTCCTCCACCTTGG + Intergenic
936006269 2:108891930-108891952 TGCAATTCAATCCACCACCTTGG - Intergenic
936288776 2:111201533-111201555 TGGTCTTCCCTCCAGCAGCTGGG - Intergenic
937034080 2:118766071-118766093 TGGGTTTCTCTCCCCCTCCTAGG - Intergenic
937385508 2:121428269-121428291 TGGGGTTCCCTGCCCCAGCTAGG - Intronic
938739139 2:134214380-134214402 TTGGCTTCCCTCGACCACATTGG + Intronic
940450090 2:153826189-153826211 TGTGATACCCTGCACCACCTTGG - Intergenic
940793743 2:158055196-158055218 TGTGATACCCTGCACCGCCTTGG - Intronic
940866318 2:158820869-158820891 TGTGATGCTCTGCACCACCTCGG + Intronic
946410852 2:219514553-219514575 TGGGAGTGACTCCCCCACCTCGG + Exonic
947105378 2:226663071-226663093 TGTAATGCCCTGCACCACCTGGG - Intergenic
947611743 2:231528951-231528973 TGGGGTTCCTTGCACCCCCTGGG + Exonic
948036295 2:234860960-234860982 TGTGATGCCCTGCACCACCTCGG - Intergenic
948966443 2:241384340-241384362 TGGGATCCCCTCTACCACTGTGG - Intronic
949059416 2:241948079-241948101 TGGGGCGCCCTCCACCACCCAGG - Intergenic
1170152343 20:13238710-13238732 TGTGACTTTCTCCACCACCTGGG - Intronic
1170935508 20:20805806-20805828 TGGGATTCCCTCCAGCCCTGGGG + Intergenic
1172315995 20:33954847-33954869 TGGGCTGCCCTCCAACCCCTGGG + Intergenic
1173460256 20:43237550-43237572 TGTGATGCCTTGCACCACCTCGG - Intergenic
1174228750 20:49026496-49026518 TGAGAATCCCACCACCATCTTGG - Intronic
1175296944 20:57915055-57915077 TGGGATGCCCTGGGCCACCTCGG - Intergenic
1175696568 20:61107172-61107194 GGGGATCCCGTCCACCACATGGG - Intergenic
1175778245 20:61666413-61666435 TGGGATTGGCTCCAGCACCAAGG - Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1176174354 20:63711656-63711678 TGGCATGACCTCCACCTCCTGGG + Intronic
1177136352 21:17308735-17308757 TGGAATTCCAGGCACCACCTGGG - Intergenic
1177785159 21:25663670-25663692 TGTGATGCCCTGTACCACCTAGG + Intronic
1177820064 21:26021801-26021823 TTGGATTCCCCCCACCCCCAAGG - Intronic
1178917794 21:36718647-36718669 TAGGACTTCCTCCACCACCAAGG - Intronic
1180595188 22:16968342-16968364 TGGCATTCCCTCCACCATGCTGG + Exonic
1180793874 22:18592363-18592385 TAGGATTCCTTCCCCCACCCTGG - Intergenic
1181227866 22:21402957-21402979 TAGGATTCCTTCCCCCACCCTGG + Intergenic
1181250786 22:21531882-21531904 TAGGATTCCTTCCCCCACCCTGG - Intergenic
1181627478 22:24131556-24131578 TCTGATCCCCTCCACCTCCTTGG + Intronic
1183669373 22:39263445-39263467 TGGGATGCCCTGCGCCATCTTGG - Intergenic
1184393663 22:44219899-44219921 TGTGATGCCCTGCACCACCTCGG - Intergenic
1184779683 22:46640837-46640859 TGGGATTTGCTCCAAAACCTCGG - Intronic
1185058621 22:48593865-48593887 TGAGGTCCCCTTCACCACCTCGG - Intronic
1185422845 22:50744699-50744721 TGTGATTCCCACGACCACATAGG - Exonic
950684997 3:14610482-14610504 TGTGATGCCTTGCACCACCTTGG + Intergenic
951611059 3:24494065-24494087 TGGGCTTCTCTCCGCCTCCTGGG - Intronic
951883534 3:27502333-27502355 AGTGATCCCCCCCACCACCTTGG - Intergenic
952177975 3:30887484-30887506 TGTAATGCCCTGCACCACCTTGG + Intronic
952225477 3:31371303-31371325 TGGGATACCCTACACTGCCTTGG - Intergenic
953659503 3:44881520-44881542 TGTGATGCCCAGCACCACCTTGG - Intronic
953664435 3:44915901-44915923 TGGTATTCCATCCACCATCCTGG + Intronic
954671682 3:52294409-52294431 AGGGTTTCCCTTCCCCACCTGGG + Intergenic
954861289 3:53692980-53693002 TGGCATGCCCTCCACCTCCTGGG - Intronic
955337165 3:58096371-58096393 TAGGATTCCCTCTACTAGCTAGG + Intronic
955889905 3:63638885-63638907 TGGCATGACCTCCACCTCCTGGG + Intergenic
959133881 3:102392446-102392468 TGTGATACCCTGCACCACCTTGG - Intronic
960766297 3:121134194-121134216 TGTGATGCCCTGCACCACCTCGG - Intronic
960952365 3:123007673-123007695 TGTGGTACCCTGCACCACCTTGG + Intronic
963309453 3:143692733-143692755 TTGGGTTCCCTGCACCACATTGG + Intronic
966043288 3:175518615-175518637 TGTGATGCCCTGTACCACCTCGG - Intronic
966750119 3:183313876-183313898 TGGGAGCCCCACCACCACCTTGG + Intronic
967144280 3:186593037-186593059 TGTGATGCCCTGCACCATCTGGG + Intronic
967379029 3:188837119-188837141 TGGGCTTCCCAGCAGCACCTTGG + Intronic
968034981 3:195540726-195540748 TGTGATGCCCTGCACCACCTTGG + Intronic
969058285 4:4415535-4415557 TGGGAAGCCCTTCACCCCCTGGG + Intronic
969700656 4:8765941-8765963 TGGGATTTGCTCCAGCCCCTTGG + Intergenic
971331931 4:25688817-25688839 TGTGATGACCTGCACCACCTTGG + Intergenic
973313930 4:48739938-48739960 TGTGAAACCCTGCACCACCTTGG + Intronic
978999663 4:115200764-115200786 TGGTCTTCCCTCACCCACCTTGG - Intergenic
980914659 4:139022859-139022881 AGTGATTCCCCCCACCTCCTTGG - Intronic
981545163 4:145886015-145886037 TGGGATCTCCTCCTTCACCTTGG + Exonic
982693504 4:158573570-158573592 TGGGCTTCCCTGGACCACATTGG - Intronic
985018821 4:185665789-185665811 TGAGACACCCTCCCCCACCTGGG - Intronic
986237843 5:5928435-5928457 TGGGACTCCCCCCACCCCCTGGG + Intergenic
986809179 5:11338255-11338277 TGGGCTTCCCTACATCACTTGGG - Intronic
987031758 5:13982923-13982945 TTAGAATCCCTCCACAACCTTGG + Intergenic
988788272 5:34584123-34584145 TATGATGCCCTGCACCACCTTGG - Intergenic
994858980 5:105163333-105163355 TGGGATTCCCTGGACAACATTGG - Intergenic
996560674 5:124825691-124825713 TGTGATGCCCTGCACCACCTGGG - Intergenic
997413048 5:133704702-133704724 TGGGCTTCACTCCACCCCCTGGG + Intergenic
997524655 5:134544513-134544535 TGGGGTTCCCTTCACCCCCCAGG - Intronic
1001298185 5:170514037-170514059 TGCGAGGCACTCCACCACCTGGG + Intronic
1003035589 6:2638171-2638193 AGGAGTTCCATCCACCACCTTGG - Intergenic
1005456380 6:26023656-26023678 AGGCATACCCACCACCACCTTGG + Intergenic
1005992739 6:30913724-30913746 TGGGAATCCCCCCAGCTCCTTGG - Intronic
1006343926 6:33464626-33464648 TGTGATGCCCTGCATCACCTTGG - Intergenic
1007240841 6:40424170-40424192 TTGGTTCCACTCCACCACCTGGG - Intronic
1007723141 6:43897865-43897887 TGGGATCCCATCCATGACCTTGG + Intergenic
1010409698 6:75546876-75546898 TGTGATGCCTTGCACCACCTTGG - Intergenic
1011847909 6:91589804-91589826 TGTGATGCCCTGCACCACCTTGG + Intergenic
1012262882 6:97108484-97108506 CAGGATTCCCTCCACCAGCATGG + Intronic
1016822241 6:148357607-148357629 TGTGCTTCTCTCCACCACCTTGG - Intronic
1017931660 6:158960674-158960696 TGTGATGCCCTGCACCACCTTGG - Intergenic
1019571681 7:1715788-1715810 GGAGATTCCCTCCTCCCCCTGGG + Intronic
1020199927 7:6071780-6071802 TGTGATGTCCTACACCACCTCGG - Intergenic
1024963317 7:55001327-55001349 TGAGATGCCCTGCACCACCTGGG + Intergenic
1025731167 7:64109480-64109502 TAGGATCACCTCCACCAGCTGGG + Intronic
1026578887 7:71597480-71597502 GGGGATTCACTCCATCACCCAGG - Intronic
1029370858 7:100149512-100149534 TGGGATTCGCTCCAGCCCCTGGG - Exonic
1029514639 7:101017751-101017773 TGGGACTCCCTTCTCCCCCTGGG + Intronic
1029514730 7:101017941-101017963 TGGGATTCCCTCCCTCCCCCTGG + Intronic
1029514917 7:101018325-101018347 TGGGACTCCCTTCTCCCCCTAGG + Intronic
1029633952 7:101771412-101771434 TGGGATGCCGTCCAACACGTTGG + Intergenic
1032018226 7:128392969-128392991 GTGCATCCCCTCCACCACCTCGG + Exonic
1033126570 7:138712166-138712188 AGGTAATCCCCCCACCACCTTGG + Intronic
1035053036 7:156015015-156015037 TGGGGCTCCCTCCTCCACCCAGG - Intergenic
1040284190 8:46091678-46091700 TGGGGCTCCAGCCACCACCTGGG - Intergenic
1042086491 8:65115008-65115030 TTGGATTCTCACAACCACCTCGG + Intergenic
1042647772 8:71006403-71006425 TGGGCTTCCCTGGACCACATTGG - Intergenic
1042782817 8:72510538-72510560 TATGATTCCCCCCATCACCTGGG + Intergenic
1043705514 8:83344000-83344022 TGTGATACCCTGCACCAACTCGG + Intergenic
1046511681 8:115211997-115212019 TGTGATCCCCTGCACTACCTTGG + Intergenic
1046524253 8:115364017-115364039 TGGGTTTCACTCCATCACCCAGG + Intergenic
1047497002 8:125415674-125415696 TGACATTCACTCCACCTCCTGGG + Intergenic
1048206660 8:132420850-132420872 TGGGTTTCTCTCCTCGACCTCGG + Intronic
1048303036 8:133265420-133265442 GGGGATGGCATCCACCACCTGGG + Intronic
1049040906 8:140111076-140111098 TGGGTTTCCCTTCACCACCCAGG + Intronic
1055064718 9:72107289-72107311 TCGGCCTCCCTCCACCTCCTGGG - Intergenic
1056177816 9:84052422-84052444 TGGGATGCCCTGTGCCACCTTGG + Intergenic
1056560323 9:87724140-87724162 TGTGATGCCCTACACCACCTTGG + Intergenic
1057225410 9:93290415-93290437 TTGGCTTCCCTGCACCACATTGG - Intronic
1057552996 9:96065767-96065789 TGGGATGCCTTGCACCACCCTGG + Intergenic
1057855709 9:98599392-98599414 TGGGCCTCACTCCATCACCTTGG + Intronic
1058231498 9:102431952-102431974 TGAGATACTCTGCACCACCTCGG + Intergenic
1058773231 9:108259245-108259267 TGGAATTCACTCTACCACTTTGG - Intergenic
1060391330 9:123279762-123279784 CGTGATGCCCTTCACCACCTTGG + Intergenic
1061837138 9:133336802-133336824 TACGATTCCCTCCCCCACCCCGG + Intergenic
1062525395 9:136976219-136976241 TGGGACTCACTCCCTCACCTTGG + Intergenic
1189369130 X:40413927-40413949 TGGAACTCCCTGGACCACCTAGG - Intergenic
1190049721 X:47140679-47140701 TGGGCTTCCCTTCACCCTCTTGG - Intergenic
1190287208 X:48969645-48969667 TGGGATGGTCTCCACCACATTGG + Exonic
1191225421 X:58037752-58037774 TGTGATTCCCTCTGCCACCTTGG + Intergenic
1192473199 X:71417245-71417267 TGGGATTCTCTGAGCCACCTCGG + Intronic
1196306653 X:114111042-114111064 TGGGCCTGCTTCCACCACCTTGG + Intergenic
1197865283 X:131010695-131010717 GGGGATTCCCTTCACAACTTGGG - Intergenic
1199320463 X:146431972-146431994 TAGGATTGCCTCGACCTCCTTGG - Intergenic
1199429949 X:147747532-147747554 TGTGATATCCTCCACCACCTTGG - Intergenic