ID: 1165310094

View in Genome Browser
Species Human (GRCh38)
Location 19:35024517-35024539
Sequence GTGTCGAGGGGGAAAGCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165310083_1165310094 23 Left 1165310083 19:35024471-35024493 CCAGCAGTTGTGGTGGGTCAGAG 0: 1
1: 2
2: 0
3: 7
4: 178
Right 1165310094 19:35024517-35024539 GTGTCGAGGGGGAAAGCGGATGG 0: 1
1: 0
2: 0
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165310094 Original CRISPR GTGTCGAGGGGGAAAGCGGA TGG Intronic
900436012 1:2631699-2631721 GTGTCTAGGGGCACAGCAGAGGG - Intronic
900817065 1:4856363-4856385 CTGTCCAGTGGGAAAGCGGGAGG + Intergenic
901556177 1:10033005-10033027 GGGGCGAGGGGGAAAGAGTAGGG + Intronic
901767909 1:11515556-11515578 GTATCCAGGGAGAAAGGGGATGG - Intronic
902549266 1:17209605-17209627 GTAAGGAGGCGGAAAGCGGAGGG - Intronic
903952138 1:27002022-27002044 GTGTGGCGAGTGAAAGCGGAAGG + Intergenic
906395673 1:45462060-45462082 GTGTTGAGTGGGAAATGGGATGG - Intronic
906802769 1:48751841-48751863 GAGTCTAGGGAGAAAGGGGAAGG + Intronic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
915970887 1:160354366-160354388 GGGTAGTGTGGGAAAGCGGAGGG - Intronic
915982276 1:160427786-160427808 GTGTCAAGGGGGTAAGAGGTGGG - Exonic
916476916 1:165178311-165178333 GTGTCAAGGGGGAAACCAGGTGG - Intergenic
917755174 1:178091815-178091837 GGGGCGTGGGGGAAAGGGGAGGG + Intergenic
920086469 1:203421307-203421329 GAGGGGAGGGGGAAAGGGGAGGG + Intergenic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
922677348 1:227561021-227561043 GCGTAGAGGGGGAGAGCGGCCGG + Intergenic
1064301427 10:14126507-14126529 GTGCCTATGGAGAAAGCGGAGGG - Intronic
1064876557 10:20001473-20001495 GTGTGGAGGGGGCAAGGGAAGGG + Intronic
1067256284 10:44645626-44645648 GTGGGGTGGGGGAAAGGGGAGGG + Intergenic
1067473825 10:46553705-46553727 TTGTGGAGGGGGAATGGGGAAGG - Intronic
1070026708 10:72638677-72638699 GTGAAGAGGGGGAAACCTGAGGG + Intergenic
1071864168 10:89707642-89707664 GTGTGAAGGGGGAAAGGGGATGG - Intronic
1071965299 10:90845828-90845850 GGGTCCAGGGGGAAAGCTCATGG - Intronic
1073617609 10:105012636-105012658 GTGTGGAGGGAGAAAACGAAAGG - Intronic
1074418245 10:113286200-113286222 GTGTCATGGGGGAAGGAGGAAGG - Intergenic
1074523448 10:114245060-114245082 GTATTGAGGGGGACAGGGGAGGG + Intronic
1074658487 10:115622003-115622025 GTGTGGAAGGGGAGAGCAGAGGG + Intronic
1076053382 10:127352320-127352342 GTGGGGAGGGGCAAAGAGGATGG + Intronic
1078050896 11:7963836-7963858 GTGTTGAGAGGGAAAGAGGAAGG - Intronic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1089500862 11:118930380-118930402 GTGTGGGTGGGGAAAGAGGAGGG + Intronic
1092676752 12:10929393-10929415 CTATAGAGGGGGAAAGTGGAGGG + Intronic
1093118983 12:15244950-15244972 GGGTAGAGGGGGAGAGAGGAGGG + Intronic
1093233556 12:16578374-16578396 GGGTAGAGGGAGAAAGGGGAGGG + Intronic
1094049441 12:26203128-26203150 GTGTTGAGGGGGAAACCTGGTGG - Intronic
1095184357 12:39184689-39184711 GTGTTGAGGGGGATGGAGGATGG - Intergenic
1096466412 12:51849272-51849294 GGGTCGAAGGGCAAAGGGGAAGG + Intergenic
1097248985 12:57621996-57622018 GTGTCGAGGGGGGCTGTGGAAGG - Intronic
1097919901 12:65060533-65060555 GTGTCTGGAGGGAAAGGGGAAGG + Intronic
1099182447 12:79483936-79483958 TTGTCCAGGGGGTAAGAGGAAGG - Intergenic
1102983679 12:117262263-117262285 GTCTCTGGGGGGAAAGGGGAGGG - Intronic
1103225242 12:119281871-119281893 GTGTCGAGGGGGTAGGTGGAGGG - Intergenic
1103425578 12:120830519-120830541 GTGGGGAGGGGGAGAGCAGAGGG + Intronic
1103884006 12:124187571-124187593 GGGTGGAGGGGGAGAGTGGAGGG + Intronic
1104736834 12:131140157-131140179 GTGTCCAGGTGGAAAGTGGAGGG + Exonic
1104800770 12:131554079-131554101 GGGTCCAGGGGGAAGGCAGAAGG + Intergenic
1107939709 13:45372803-45372825 GCATGGAGCGGGAAAGCGGAGGG - Intergenic
1107986206 13:45778440-45778462 GTGTCCGGGGAGAAAGCAGAGGG + Exonic
1110486614 13:76051955-76051977 GTGTAGAGGAGAAAAGAGGATGG - Intergenic
1110885529 13:80629202-80629224 GTGTCTTGGGAGAAAGCAGAAGG + Intergenic
1114750639 14:25200904-25200926 GTGTGGTGGGGGAAAAAGGAGGG + Intergenic
1116550790 14:46235098-46235120 GTGCCGAGGGGTAATGCAGAGGG - Intergenic
1117631448 14:57696919-57696941 GGGTTGTGGGGGAAAGGGGAGGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119773602 14:77235939-77235961 GTGTCCAGGGGGACTGCGGTGGG + Intronic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1121237602 14:92403924-92403946 GTGTTAAGAGGTAAAGCGGATGG + Intronic
1121906565 14:97751619-97751641 GTGTTTAGGAGGAAAGGGGAGGG - Exonic
1122291057 14:100680705-100680727 GAGTCTTGTGGGAAAGCGGATGG + Intergenic
1122329759 14:100904355-100904377 GTGTGGACGGGGAGAGGGGAGGG + Intergenic
1122645450 14:103190252-103190274 GTGTCAAGGGGGAGACCAGATGG + Intergenic
1128302010 15:66571868-66571890 GTGGTGAGGAGGAAAGGGGAAGG + Intergenic
1134374690 16:13660942-13660964 GTGTCGAGGGAGGAACCTGATGG + Intergenic
1138315010 16:56062413-56062435 GTGTCCAGGGGGAAAGTAAAGGG + Intergenic
1139624998 16:68180642-68180664 GTGGGGTGGGGGAAAGTGGAAGG - Intronic
1139754509 16:69132189-69132211 GTGTGGAGACGGAAGGCGGAGGG - Intronic
1140937336 16:79685764-79685786 GTGTCCAGGTGGAAAGCCAATGG + Intergenic
1142234538 16:88915520-88915542 GTGTGGAGGGGGAGCGTGGAGGG + Intronic
1144187409 17:12809583-12809605 GTGTCAAGGGAGAAACCTGATGG - Intronic
1147315696 17:39619083-39619105 GTGTGGAAGGGGAAAGCTGGAGG - Intergenic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148747966 17:49928964-49928986 GTGTGGAGGGGGAAGGCTGTGGG - Intergenic
1151284088 17:73097170-73097192 GTGGCGGGGGGGCAAGCAGAGGG + Intergenic
1152235798 17:79137662-79137684 GTGTCGGGGGAGGAGGCGGATGG + Intronic
1152288579 17:79426006-79426028 GTGTGGAGGGGGAGAGAGCAAGG + Intronic
1153963341 18:10158761-10158783 GTGTAGAGGGGGAAAGAAAAAGG - Intergenic
1156229643 18:35140900-35140922 GTGTCGTGGGGGAAAACATAAGG + Exonic
1157095469 18:44682246-44682268 GTGTCGTGGGAGAAAGGGGATGG + Intronic
1161081126 19:2310659-2310681 GTGAAGAGGGGGAAAGGGGCGGG - Intronic
1161226154 19:3146905-3146927 GTGAGGAGGGGGAGAGAGGAAGG - Intronic
1162934614 19:13975493-13975515 GAGTTGAGGGGGACAGTGGAAGG + Intronic
1163698335 19:18775106-18775128 GGGCCGAGGGGCAAAGCTGAGGG - Intronic
1165310094 19:35024517-35024539 GTGTCGAGGGGGAAAGCGGATGG + Intronic
1165984465 19:39755914-39755936 GAGTAGAGGGGGAAAGAGGTAGG - Intergenic
1166822658 19:45590142-45590164 GTGACTCGGGGGAAAGTGGAAGG - Exonic
1166861764 19:45815534-45815556 GGCTCGAGGGGGAAAGGGGGTGG - Exonic
1167333073 19:48868100-48868122 GTGACGGGGGGGCAAGAGGACGG + Exonic
1167421103 19:49403855-49403877 GTGTGGAGGGGGAAGGTAGAGGG - Intronic
1167723600 19:51195994-51196016 CTGTTGAGGGGGAAAGCAGCTGG - Intergenic
1168509263 19:56961527-56961549 GAGGGGAGGGGGAAAGAGGAGGG - Intergenic
925751132 2:7091152-7091174 GGGCCGAGGGTGAAAGAGGAAGG + Intergenic
925755406 2:7128115-7128137 GGGGGGAGGGGGAAAGGGGAGGG - Intergenic
926406799 2:12561850-12561872 GTGTAGAGAGGGAAGGTGGAGGG + Intergenic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
928340566 2:30439788-30439810 GTGGGGAGGAGGAAAACGGAGGG - Intergenic
929073987 2:38062231-38062253 TTGTCGAGGGTTAAAGGGGAGGG - Intronic
930088285 2:47513910-47513932 GAGTGGAGGAGGAAAGCAGATGG - Intronic
932707918 2:74040949-74040971 GAATTGAGGGGAAAAGCGGAGGG + Intronic
932744889 2:74325862-74325884 GAGGGGAGGGGGAAAGGGGAAGG + Intronic
933334231 2:80936248-80936270 GGGTCGTGGGGGAAAGAGAATGG + Intergenic
933780341 2:85796600-85796622 GTGCTGAGGGGGAAGGCAGACGG - Intergenic
937096537 2:119239205-119239227 GTGTAGAGAGGGAAAGAGGAAGG - Intronic
938994908 2:136668102-136668124 GTGTCGAGGGAGAAACCTGGTGG - Intergenic
939591628 2:144071283-144071305 GTTTCGAGGGGGATAGGGGTTGG + Intronic
940306494 2:152232691-152232713 GTGGAGATGGGGAAAGTGGATGG - Intergenic
941029481 2:160494034-160494056 GGGTGGAGGGGGAATGCGGGGGG + Intergenic
942619120 2:177828925-177828947 GTATAGAGGGGCAAAGTGGAAGG + Intronic
943570582 2:189569292-189569314 GTTTAGAGGGTGAAAGGGGAGGG - Intronic
946590545 2:221242574-221242596 GTGTGGTGGGGGAGAGGGGAGGG + Intergenic
948217423 2:236242213-236242235 GTGGCGTGGGGGACAGAGGATGG - Intronic
948550807 2:238772108-238772130 ATGCCGAGGGGGAGAGTGGAAGG - Intergenic
1170408968 20:16067886-16067908 GAGTGGAGGGGGGAAGAGGATGG - Intergenic
1171209704 20:23307764-23307786 GTGTGGTGGGGGGAAGCGGGAGG + Intergenic
1171278993 20:23880953-23880975 GTGTCCAGGTGGAAGGCGCAGGG + Intergenic
1171412574 20:24956981-24957003 GTGTCGGGGGGGACAGGTGAGGG + Intronic
1173567155 20:44049641-44049663 GCGTTGAGGGGGCAAGGGGAGGG - Intronic
1177578131 21:22984468-22984490 GTGTCTAGGGAGAAACTGGATGG - Intergenic
1180951848 22:19723991-19724013 GTGTCGACAGGGAAGGCGGTCGG - Exonic
1183390306 22:37541952-37541974 GTGGGGAGGAGGAAAGCAGAGGG - Intergenic
1184355923 22:43979574-43979596 GTGTAGAGGGGGGAAGGGGAAGG - Intronic
949507872 3:4743732-4743754 TTGTTGAGGGGGAAGGGGGAGGG + Intronic
954063651 3:48088995-48089017 GTGGCGAGGGGGAGGGCGGAGGG + Exonic
955984870 3:64561813-64561835 GTGTCGAGGGTCACAGAGGAGGG + Intronic
958506397 3:94984249-94984271 GTGGAGTGGGGGAAAGGGGAAGG - Intergenic
970335347 4:15033870-15033892 GTGTGGAGAGGGAAATAGGAAGG + Intronic
972812529 4:42606317-42606339 GTGTTGAGGGTGAAAGAGAAGGG - Intronic
975490424 4:74982294-74982316 GGGTCGGGGGTGAAAGAGGAGGG + Intronic
977368471 4:96102708-96102730 GTGTTGGGGGGGAAAGCTTAGGG + Intergenic
981443946 4:144813013-144813035 GTGGGTAGGGGGAAAGGGGAGGG + Intergenic
985034980 4:185829553-185829575 GTGTCTAGTGGGAACGGGGATGG - Intronic
985165331 4:187088254-187088276 GTGTGGAGGGTGAATGCTGATGG + Intergenic
987555039 5:19435643-19435665 GTGTCGAGGGAGAGAGGTGATGG + Intergenic
990073810 5:51817652-51817674 GTGCTGAGGGGGAAAGAGAAGGG + Intergenic
992024133 5:72654137-72654159 GGGTCCAGGGAGAAAGGGGAGGG - Intergenic
994021038 5:95026423-95026445 GGGTTGAGGGGAAGAGCGGAGGG - Intronic
996166407 5:120229022-120229044 TTGTCGAGGGGGATAGAGGCAGG + Intergenic
996890332 5:128411427-128411449 ATGGGGAGGTGGAAAGCGGACGG + Intronic
997682903 5:135768652-135768674 GTATCCAGGGGGAAATAGGATGG + Intergenic
998684227 5:144505719-144505741 GTGTGGTGGGGGGAAGGGGAAGG + Intergenic
1002400497 5:178989190-178989212 GTGGGGAGGGGGAAGGCGGGAGG - Intronic
1002686740 5:181017818-181017840 GGGTGGAGGGGGAAAGGGGAGGG + Intergenic
1003036067 6:2641263-2641285 GTGTTGAGGAGGAAACCAGATGG - Intergenic
1005498902 6:26412964-26412986 GTGTCCAGAGGGGAAGAGGAGGG - Intronic
1006984156 6:38166548-38166570 GTGCGGAGGGGGAAGGTGGAGGG - Intergenic
1007273355 6:40655527-40655549 GTGTCCAGAGGGAAAAGGGAAGG + Intergenic
1009224075 6:61007076-61007098 ATATCGAGAGGGAAAGAGGATGG + Intergenic
1012743694 6:103055046-103055068 ATGGGGAGGTGGAAAGCGGATGG + Intergenic
1013869784 6:114743156-114743178 GTGTGGAGGGGGAGTGGGGAGGG - Intergenic
1019361044 7:604336-604358 GTGTGGAGGGGGAAGGCTGGAGG - Intronic
1022841067 7:34164290-34164312 GTGTAGTGGGGGAAAGAGAAGGG - Intergenic
1026471872 7:70700607-70700629 GTGTGGAGGGGGAAAGCATCGGG + Intronic
1028086614 7:86644569-86644591 GTGGGGAGTGGGAAAACGGAGGG - Exonic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1031760294 7:125705589-125705611 GTGTCAAGGGGGGAACCAGATGG + Intergenic
1033927264 7:146478659-146478681 GTGTAGAGGGGAAGAGGGGAGGG - Intronic
1041154094 8:54965929-54965951 GTGTGGAGGGGGCAAGAGAAGGG + Intergenic
1041216667 8:55607844-55607866 GTGGGGAGCTGGAAAGCGGATGG - Intergenic
1041924380 8:63221548-63221570 GGGGGGAGGGGGAAAGGGGAGGG - Intergenic
1042357997 8:67850585-67850607 GGGGCTAGGGGGAAAGGGGATGG - Intergenic
1042464852 8:69116724-69116746 GTGGGGAGGGGGCAAGCGGGAGG + Intergenic
1043464199 8:80487982-80488004 GTGTTGTGGGGGGAAGGGGATGG + Intronic
1043714542 8:83466004-83466026 GTGTCTAGGGAGAAACCAGATGG + Intergenic
1049262423 8:141646752-141646774 GCATGGAGGGGGAAAGAGGATGG - Intergenic
1052732530 9:32306693-32306715 GAGTCCAGGGGCAAAGGGGAAGG - Intergenic
1055849944 9:80614840-80614862 GTGTGGAGGGGGAGACAGGAAGG - Intergenic
1060439576 9:123626349-123626371 GTGTCTGGGGGGAGAGGGGATGG + Intronic
1186477350 X:9867831-9867853 GTGTGGTGGGGGAAGGCTGATGG + Intronic
1186982190 X:14969138-14969160 CTGTCGTGGGGGAGAGAGGAGGG - Intergenic
1187253464 X:17620866-17620888 GTGGGGAGGGGAAAAGTGGAGGG + Intronic
1188037522 X:25335270-25335292 GGGTTGAGGGGGTAAGGGGAGGG - Intergenic
1189322730 X:40096385-40096407 GAGAGGAGGGGGAAAGCGGGAGG + Intronic
1192590470 X:72355420-72355442 GTGCTGAGGGGGAAAGGGGAAGG - Intronic
1194505750 X:94731315-94731337 GTGTCAAGGGAGAAACCTGATGG - Intergenic
1197696943 X:129560067-129560089 GTATTAAGGGGGAAAGCAGAAGG - Intronic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1199736718 X:150692935-150692957 GTATGGAGGGGGAGAGTGGAGGG + Intergenic