ID: 1165311137

View in Genome Browser
Species Human (GRCh38)
Location 19:35030210-35030232
Sequence CAGACTCCCTGGGAAGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165311118_1165311137 30 Left 1165311118 19:35030157-35030179 CCGGCCCCCAAACTGCGCTCTAA No data
Right 1165311137 19:35030210-35030232 CAGACTCCCTGGGAAGGTGGGGG No data
1165311120_1165311137 25 Left 1165311120 19:35030162-35030184 CCCCAAACTGCGCTCTAAGTCCT No data
Right 1165311137 19:35030210-35030232 CAGACTCCCTGGGAAGGTGGGGG No data
1165311121_1165311137 24 Left 1165311121 19:35030163-35030185 CCCAAACTGCGCTCTAAGTCCTC No data
Right 1165311137 19:35030210-35030232 CAGACTCCCTGGGAAGGTGGGGG No data
1165311122_1165311137 23 Left 1165311122 19:35030164-35030186 CCAAACTGCGCTCTAAGTCCTCC No data
Right 1165311137 19:35030210-35030232 CAGACTCCCTGGGAAGGTGGGGG No data
1165311119_1165311137 26 Left 1165311119 19:35030161-35030183 CCCCCAAACTGCGCTCTAAGTCC No data
Right 1165311137 19:35030210-35030232 CAGACTCCCTGGGAAGGTGGGGG No data
1165311128_1165311137 2 Left 1165311128 19:35030185-35030207 CCTGTGACTCTGGGGGTGACCTT No data
Right 1165311137 19:35030210-35030232 CAGACTCCCTGGGAAGGTGGGGG No data
1165311127_1165311137 5 Left 1165311127 19:35030182-35030204 CCTCCTGTGACTCTGGGGGTGAC No data
Right 1165311137 19:35030210-35030232 CAGACTCCCTGGGAAGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165311137 Original CRISPR CAGACTCCCTGGGAAGGTGG GGG Intergenic
No off target data available for this crispr