ID: 1165312487

View in Genome Browser
Species Human (GRCh38)
Location 19:35037249-35037271
Sequence CTGTGTTAGGAGAAGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 555}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165312477_1165312487 25 Left 1165312477 19:35037201-35037223 CCTGGAAGAGGTGGAGAAGATGC 0: 1
1: 0
2: 2
3: 32
4: 333
Right 1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG 0: 1
1: 0
2: 4
3: 40
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165312487 Original CRISPR CTGTGTTAGGAGAAGGCAGA TGG Intronic
900510947 1:3060829-3060851 CTGTGTTTGGAAAAGGAAGCTGG - Intergenic
901094266 1:6665769-6665791 CTGTGTTAGGAGCAGTGAAAGGG - Intronic
901471188 1:9457552-9457574 CTTTGGTAGGCCAAGGCAGAAGG + Intergenic
902351407 1:15858195-15858217 CTTTGGTAGGACAAGGCAGGAGG - Intronic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
902989015 1:20173063-20173085 CTTTGTGAGGATAAGGCAGGAGG + Intronic
903271034 1:22188449-22188471 CAGGGTTAGGGGCAGGCAGAGGG - Intergenic
903406586 1:23102396-23102418 CTGTGTTGGGAGAAGGGGCAGGG - Intronic
903513990 1:23897816-23897838 CTGGTTTATGAGAAGGCAGCTGG + Intronic
903920868 1:26799759-26799781 GTGTCTTGGCAGAAGGCAGAGGG - Intergenic
904805526 1:33128908-33128930 CTGTGTTAGTGGAAAGCACAGGG + Intergenic
904879217 1:33682221-33682243 CTTTGTAAGAAGAAGACAGAGGG - Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905476961 1:38235741-38235763 CTGTGTTGGGAAAAGAAAGAAGG - Intergenic
906350805 1:45057281-45057303 CTGTCTTAGCAGAATGCTGAGGG + Intronic
906779942 1:48564365-48564387 ATGGGTCAGGAGAAGGCAGCAGG - Intronic
907099733 1:51819056-51819078 CTGTGGGAGGCGAAGGCAGGCGG + Intronic
908745721 1:67374717-67374739 CTGTGAGAGGCCAAGGCAGACGG - Intronic
908806775 1:67939956-67939978 CTATGATAGGAGAAAGCAAATGG + Intergenic
909457793 1:75869811-75869833 CTCTGTTAGGACAGTGCAGAAGG + Intronic
909611096 1:77552557-77552579 CTGTGATAGTAAAAGGCAGAAGG + Intronic
910144470 1:84063306-84063328 CTTTGGGAGGAGAAGGCAGGTGG - Intergenic
911049082 1:93654326-93654348 CAGTGTTATGAGAAGGCCTATGG + Intronic
911434831 1:97844420-97844442 CTATCCTAGGAGAAGGGAGAGGG + Intronic
912936922 1:114011781-114011803 CTGTGGGAGGCCAAGGCAGAAGG - Intergenic
913338430 1:117732918-117732940 CTCTGTGAGGTGAAGGCAGTGGG - Intergenic
915252209 1:154598631-154598653 GTCTCTTTGGAGAAGGCAGAAGG - Intronic
916074581 1:161193135-161193157 CTTTGTTATCAGAAAGCAGAGGG + Intronic
916627069 1:166569944-166569966 CTCTTGTAGGAGAAGGCTGAAGG + Intergenic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
917336041 1:173925250-173925272 CTGTGTTAGGAGTAGGTTCAAGG + Intergenic
917452509 1:175158607-175158629 CTGGGTTTGGTGCAGGCAGATGG + Intronic
917619638 1:176782962-176782984 ATGGGTTAGAAGAAAGCAGATGG + Intronic
917634035 1:176917842-176917864 CTGTGTTTGGTGAAGGCACGTGG - Intronic
918028478 1:180778509-180778531 CTGTGTTTGGAGCAGGTAGTGGG + Intronic
918083370 1:181224354-181224376 CTATTATAAGAGAAGGCAGAGGG + Intergenic
918123019 1:181556484-181556506 CTGTGGGAGGGGGAGGCAGAGGG + Intronic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
918912820 1:190595529-190595551 CTCTGTTATGAGAAGGAATAGGG + Intergenic
919798122 1:201333533-201333555 CTTTGAGAGGCGAAGGCAGAAGG - Intergenic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920702159 1:208226078-208226100 CTGGGCTAGGTGAAGGCAGCAGG - Intronic
921952976 1:220951984-220952006 CTGAGTTAGAAGAAGTAAGAAGG + Intergenic
922192027 1:223327778-223327800 CTGTGATAGGGTTAGGCAGATGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923015839 1:230126226-230126248 CTGTGCTAGGAGAGGGCTGTAGG + Intronic
923695125 1:236241298-236241320 CTGTGGGAGGCCAAGGCAGACGG + Intronic
923713570 1:236406195-236406217 CTGTGATAGGAGGAGGGAGAAGG + Intronic
1062859745 10:802310-802332 CTGTGGGAGGCTAAGGCAGAAGG - Intergenic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1063676543 10:8145577-8145599 TTGTGTTTGTAAAAGGCAGAGGG + Intergenic
1065167748 10:22998310-22998332 CTGTGTTTGCAGAACGCAGTGGG - Exonic
1066479850 10:35785387-35785409 CTGTTTTTGGAGAAGGCAGCAGG - Intergenic
1067177584 10:43960877-43960899 CTGTGTTTGGAGACAGCAGGTGG - Intergenic
1067383661 10:45798569-45798591 TTGTGATAGGAGAAGGCTGTGGG + Intergenic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1067880518 10:50040232-50040254 TTGTGATAGGAGAAGGCTGTGGG - Intergenic
1067891363 10:50139136-50139158 TTGTGATAGGAGAAGGCTGTGGG + Intergenic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068153714 10:53168705-53168727 CTGTGTTACAACATGGCAGAAGG - Intergenic
1068502846 10:57861988-57862010 CAGTGTCTGGAGAAGGGAGACGG - Intergenic
1069184397 10:65404856-65404878 GTGTGTCAGGAAAAGGCACAAGG + Intergenic
1070169209 10:73920094-73920116 CTGAGGTGGGAGAGGGCAGAGGG - Intronic
1070205780 10:74259698-74259720 CTTTGGGAGGCGAAGGCAGACGG - Intronic
1070664260 10:78332363-78332385 CTCTGTTACTTGAAGGCAGACGG + Intergenic
1070725324 10:78783759-78783781 CTGTGTTGGGAAAAGACAGGAGG - Intergenic
1071074333 10:81732877-81732899 ATGGGGTAGGAGAAGGGAGATGG - Intergenic
1073269182 10:102247288-102247310 GTGTGTTGGGAGAAGGGGGATGG + Intronic
1073513879 10:104060315-104060337 ATGTGCCAGGAGAAGGGAGAGGG + Intronic
1074250949 10:111746918-111746940 ATGAGTTATGAGAATGCAGAGGG + Intergenic
1075428824 10:122363914-122363936 CTGTGTTGGGCAAAGGAAGATGG + Intergenic
1075774352 10:124970503-124970525 CTGTGTGAGGCCAAGGCAGGAGG - Intronic
1075784067 10:125036542-125036564 CTGTGTCAGGTGTAGGCAGTGGG + Intronic
1075866451 10:125725108-125725130 CTGGCTTAGGAGGAGGAAGACGG + Intronic
1075866861 10:125729997-125730019 GTGTGTGAGGAGCAGGCAGTAGG + Intronic
1076412623 10:130262723-130262745 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076412846 10:130264164-130264186 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076822658 10:132947143-132947165 CGGTGTCTGCAGAAGGCAGAGGG - Intergenic
1076984203 11:223624-223646 ACGTGTGAGGAGAAGGGAGAAGG - Intronic
1077045239 11:541770-541792 CTGTGTCAGGTACAGGCAGAGGG + Intronic
1077418520 11:2437106-2437128 CTGTCTTAGGAGAAGGGATGGGG + Intergenic
1077544049 11:3161253-3161275 GTGTGTTTGGTGAATGCAGATGG - Intronic
1078435007 11:11317191-11317213 CTTGGATAGGAGAAAGCAGAGGG - Intronic
1078537218 11:12184953-12184975 GTGAGTTAGGAAAAGGCCGATGG + Intronic
1078723726 11:13908775-13908797 CTGTGAGATTAGAAGGCAGAAGG - Intergenic
1079259359 11:18863600-18863622 CTGAGGTGGAAGAAGGCAGATGG - Intergenic
1079504303 11:21136249-21136271 ATGTGTGAGGAAAAGACAGAAGG + Intronic
1080327961 11:31100059-31100081 CTGTGCTAGGATATGGCACAAGG + Intronic
1080909496 11:36581395-36581417 CTCTGCTAGGAAAATGCAGAGGG - Intronic
1081678523 11:44985458-44985480 GTGTGTTAGGAGAATGCATGAGG - Intergenic
1081864613 11:46352651-46352673 CTGTTCAAGGAGGAGGCAGAGGG - Intronic
1081939668 11:46929875-46929897 CTTTGGTAGGCCAAGGCAGATGG - Intergenic
1084303932 11:68269491-68269513 CTGTGTTGGGAGCAGGCCCATGG - Intronic
1084463241 11:69307838-69307860 CTGAGCTGGGAGAAGGAAGATGG - Intronic
1085124736 11:73992144-73992166 CTGAGTATGGAGAAGGCAAAAGG - Intergenic
1085832505 11:79916473-79916495 CTGGGTTTGGAGAGGGCAGTTGG + Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1087537925 11:99475271-99475293 CTGTGTTATGACAGGGCAGATGG - Intronic
1088762811 11:112948417-112948439 CTCTGTTAGGACAGTGCAGAAGG - Intergenic
1089274980 11:117328495-117328517 CTGAGTTAGGAGAACGGACAGGG - Intronic
1089279958 11:117366996-117367018 CTGTGAAAGGAGGAGACAGAAGG + Intronic
1089654073 11:119934438-119934460 CTGTGGTAGGAAGAGGCAGAAGG - Intergenic
1091822864 12:3489749-3489771 CTGTGTTCTGAGAAGGGAAAAGG + Intronic
1092146276 12:6216795-6216817 CTGTGATCGGAGAAGGCGGCTGG - Intronic
1093634344 12:21446666-21446688 CTTTGTGAGGCCAAGGCAGACGG + Intronic
1093722769 12:22463508-22463530 CTGTGTTATCACAGGGCAGAAGG - Intronic
1096960220 12:55569930-55569952 CTCTGGTAGGGCAAGGCAGAAGG - Intergenic
1097370479 12:58773218-58773240 CTGTGTTATAACATGGCAGAAGG - Intronic
1098306819 12:69110580-69110602 GTGTGATAGGTGAAGGCAAAGGG - Intergenic
1099894844 12:88632275-88632297 CTTTGGGAGGCGAAGGCAGAAGG - Intergenic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1100455511 12:94747953-94747975 CTGTGTCATGACATGGCAGAGGG - Intergenic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1102257970 12:111427140-111427162 CTTTGGGAGGCGAAGGCAGATGG + Intronic
1102290141 12:111692674-111692696 CTGTGTGGGAAGAAGGCACAGGG - Intronic
1102562356 12:113771130-113771152 CTGTGTTGCGAGGAGACAGACGG - Intergenic
1104247253 12:127055794-127055816 CTGTGCTTGATGAAGGCAGAGGG - Intergenic
1104520921 12:129474253-129474275 ATGTGTTAGGAGGGAGCAGAAGG - Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1106091315 13:26597612-26597634 CTGTTCTGGGGGAAGGCAGAGGG - Intronic
1106098094 13:26668276-26668298 CTGAGCTGGGAGAAGGCAGGAGG - Intronic
1106678334 13:31984837-31984859 CTGTGCTAGGACAGTGCAGAAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107635473 13:42388125-42388147 CTGTGTCAGCAGAAAGCAAAGGG + Intergenic
1107930489 13:45303032-45303054 CTGTGTAAAGAGAAGTCAGGGGG + Intergenic
1108180275 13:47833796-47833818 GGGAGTTGGGAGAAGGCAGAAGG + Intergenic
1109276159 13:60306463-60306485 CTGTGTTAGGGCAGTGCAGAAGG - Intergenic
1109440850 13:62370927-62370949 CTGTGTCAGGCAAAGGCAGGAGG - Intergenic
1110885529 13:80629202-80629224 GTGTCTTGGGAGAAAGCAGAAGG + Intergenic
1111178851 13:84635827-84635849 CTGTGGTAGGAGGAGGCTGTAGG - Intergenic
1111258967 13:85710218-85710240 CTCACTTGGGAGAAGGCAGAGGG + Intergenic
1111987279 13:95077978-95078000 CTGGGTTGGGGAAAGGCAGATGG + Intronic
1112111650 13:96306452-96306474 CTTTGGGAGGCGAAGGCAGATGG - Intronic
1112375254 13:98833810-98833832 CTATGTGATGAGAAGGCAGCAGG - Intronic
1112825032 13:103382265-103382287 CTCTGTTAGGAGCATGCAGAAGG - Intergenic
1113277980 13:108754895-108754917 CTGTGTTAGGAAAACACAGCAGG + Intronic
1113536887 13:111075210-111075232 CTTTGTGAGGACAAGGCAGGAGG - Intergenic
1113616251 13:111682733-111682755 CTTTGTTAGGCCAAGGCAGGTGG + Intergenic
1113621719 13:111767626-111767648 CTTTGTTAGGCCAAGGCAGGTGG + Intergenic
1113638414 13:111938196-111938218 CTGTGATATGAGCAGACAGAGGG + Intergenic
1114147425 14:19993792-19993814 CTCTGCTAGGACAATGCAGAAGG - Intergenic
1114430869 14:22659245-22659267 AAATGTTAAGAGAAGGCAGAGGG - Intergenic
1114871077 14:26659270-26659292 CTTTGGTAGGTCAAGGCAGAAGG - Intergenic
1115225268 14:31095660-31095682 CTTTGGAAGGCGAAGGCAGATGG - Intronic
1115383603 14:32769289-32769311 CTGTGGGAGGAGGAGGCAGGCGG - Intronic
1115766160 14:36625540-36625562 CTCTGTTTGGAGAAGGAAGCCGG - Intergenic
1116236679 14:42287145-42287167 CCTTGTTAAAAGAAGGCAGAAGG - Intergenic
1117084088 14:52181226-52181248 CTCTGTTAGGGCAATGCAGAAGG - Intergenic
1117359389 14:54958368-54958390 CTGTGGGAGGCCAAGGCAGACGG - Intronic
1118451001 14:65902044-65902066 CTTGGTGAGGAGGAGGCAGAGGG + Intergenic
1118769839 14:68935352-68935374 CTCTGACAGGAGAAGGGAGAGGG - Intronic
1120005260 14:79349357-79349379 CTGTGTAAGCAGAAAGCAGGAGG + Intronic
1120485867 14:85112701-85112723 CTCTGCTAGGAGAGTGCAGAAGG - Intergenic
1120707674 14:87761391-87761413 CTGTGCTAGGGCAATGCAGAAGG + Intergenic
1120808724 14:88780814-88780836 CTTTGGGAGGACAAGGCAGATGG - Intronic
1121019816 14:90573069-90573091 CTTTGTGAGAAGATGGCAGAGGG - Intronic
1121160506 14:91734963-91734985 CTTTGATAGGCCAAGGCAGATGG - Intronic
1121729080 14:96173864-96173886 CTCTGTGAGGAGAGGGCAGGTGG + Intergenic
1122260724 14:100520360-100520382 ATGTGTTAAGGTAAGGCAGATGG - Intronic
1122674088 14:103396007-103396029 CTGAGTCGGGAGAGGGCAGAAGG + Intronic
1122712697 14:103671612-103671634 CTGTGGGAGGCTAAGGCAGATGG - Intronic
1122958785 14:105085088-105085110 CTGTGGGAAGTGAAGGCAGAGGG - Intergenic
1123960672 15:25396359-25396381 CTTTGTGAGGCCAAGGCAGAAGG + Intronic
1124831950 15:33157561-33157583 GTTTGTTAGTAGAAGGCAGTAGG - Intronic
1125405323 15:39347089-39347111 CTTTGGGAGGCGAAGGCAGACGG + Intergenic
1125476081 15:40048848-40048870 CTGGGGTAGGAGGAGGCAGGGGG - Intergenic
1125599094 15:40906056-40906078 CTGGCTTAGGAGAAGACAGAAGG - Intergenic
1125841796 15:42808604-42808626 CTTTGTGAGGCCAAGGCAGAAGG + Intronic
1125923973 15:43546532-43546554 CTTTGTTAGGCCAAGGCAGGAGG - Intronic
1126935950 15:53708019-53708041 ATGTGGAAGGTGAAGGCAGAGGG - Intronic
1127293518 15:57591102-57591124 CTCTGTTAGGGGACAGCAGAGGG + Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1130627057 15:85526512-85526534 CTTTGCTAGGTGGAGGCAGAAGG - Intronic
1131329209 15:91480661-91480683 CTGTGTAAGCAGGAGACAGAAGG + Intergenic
1132284369 15:100650439-100650461 CAGGGATAGGAGGAGGCAGAGGG + Exonic
1133236559 16:4389913-4389935 CTGTGCTAGGAGCTGGCAGTGGG + Intronic
1133619521 16:7513018-7513040 CTTTGGGAGGACAAGGCAGATGG + Intronic
1134049911 16:11130291-11130313 CCGTGTTCAGAGAAGGGAGAAGG - Intronic
1135098129 16:19581504-19581526 CCCTGTGGGGAGAAGGCAGAAGG - Exonic
1135544347 16:23355709-23355731 CTGTGTTAGGAAAAGTCTGCAGG + Intronic
1137489289 16:48918285-48918307 CTGTGTTAGGCCAAGGCAGAAGG - Intergenic
1137773803 16:51039657-51039679 GTGTGTCAGGAGAAGGCCGAGGG + Intergenic
1138029754 16:53550914-53550936 CTGGGATTGGGGAAGGCAGAAGG - Intergenic
1138428475 16:56952103-56952125 CTTTGGTAGGCCAAGGCAGATGG - Intergenic
1138459184 16:57138002-57138024 CAAGGTCAGGAGAAGGCAGAAGG - Intronic
1141625358 16:85258634-85258656 CTGTGGGAGGAGGAGGGAGAGGG + Intergenic
1143245227 17:5479061-5479083 CTTTGAGAGGTGAAGGCAGACGG - Intronic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1145079015 17:19879294-19879316 CTTTGGGAGGAGAAGGCAGTAGG - Intergenic
1145787171 17:27601678-27601700 CACTGCTAGGAGATGGCAGAAGG + Intronic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1148334934 17:46834726-46834748 CTGAGTTGTGAGAGGGCAGAGGG - Intronic
1148922723 17:51053441-51053463 CTTTGGTAGGCCAAGGCAGATGG + Intronic
1149480606 17:57000304-57000326 CAGTGTTAGGATAATGCTGATGG + Intronic
1149990265 17:61379304-61379326 CCATGTTTCGAGAAGGCAGAGGG - Intronic
1150901652 17:69284688-69284710 CTGTCTTAACAGAAGACAGATGG + Intronic
1151696046 17:75718157-75718179 CTTTGGGAGGACAAGGCAGACGG + Intergenic
1151847679 17:76668820-76668842 CTTTGGGAGGTGAAGGCAGAAGG + Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1155014132 18:21815424-21815446 CTTTGGGAGGACAAGGCAGAAGG - Intronic
1155075578 18:22351195-22351217 GTGTGTTGGGGGAAGGGAGATGG + Intergenic
1155109141 18:22696891-22696913 CTGTGGTTGGAAGAGGCAGATGG - Intergenic
1155316128 18:24571998-24572020 GTGTGTTGGGAGAAGACTGAGGG - Intergenic
1155963089 18:32011636-32011658 CTTTGTGAGGTGAAGGCAGGAGG + Intergenic
1156215183 18:34990775-34990797 CTTTGGCAGGACAAGGCAGAAGG + Intronic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1157232605 18:45932954-45932976 CTGTGTTAGCATGTGGCAGATGG - Intronic
1157802224 18:50630063-50630085 CTGTGTTGGGAGATGGGGGAGGG + Intronic
1157948076 18:52003633-52003655 CTGAGGGAGGAGAAGCCAGAAGG - Intergenic
1158388887 18:57026944-57026966 CTGTGATAGGGAAAGGGAGAGGG + Intronic
1158487859 18:57884037-57884059 CTGTGTTATAACATGGCAGAAGG + Intergenic
1159189648 18:65025200-65025222 CATAGTTAGGAGAAGGGAGAAGG - Intergenic
1159279324 18:66265014-66265036 CTGGTTTAGGAGAAGGGAAAAGG - Intergenic
1159692226 18:71503578-71503600 ATGTGTTAGGTGGAGGGAGATGG - Intergenic
1159786050 18:72715596-72715618 CTTGGTTAGGGGAAGGCAGATGG + Intergenic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1159972934 18:74676333-74676355 CTTTGGAAGGAGAAGGCAGGCGG - Intronic
1160344311 18:78120208-78120230 CTGTGATATGAGAAGGAATAAGG + Intergenic
1160503960 18:79417089-79417111 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160503987 18:79417181-79417203 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160503994 18:79417205-79417227 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504006 18:79417246-79417268 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504018 18:79417287-79417309 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504031 18:79417335-79417357 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504043 18:79417375-79417397 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504055 18:79417416-79417438 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504062 18:79417440-79417462 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504075 18:79417488-79417510 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504087 18:79417528-79417550 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504099 18:79417569-79417591 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504111 18:79417610-79417632 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504124 18:79417658-79417680 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504136 18:79417698-79417720 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504143 18:79417722-79417744 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504155 18:79417763-79417785 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504167 18:79417804-79417826 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504180 18:79417852-79417874 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504192 18:79417892-79417914 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504199 18:79417916-79417938 CTGTGGTGGGAGATGGGAGATGG + Intronic
1161466550 19:4433841-4433863 CTTTGGGAGGACAAGGCAGACGG - Intronic
1161787026 19:6333120-6333142 CTGTGGTAGGGGGAGGCAGAGGG - Intronic
1162175122 19:8824616-8824638 CTGCGATGGGAGGAGGCAGAAGG - Intronic
1162279762 19:9686272-9686294 CTGTGGGAGGCCAAGGCAGATGG - Intergenic
1164484949 19:28647344-28647366 CTTTGTGAGGAGAAGGCAGGAGG - Intergenic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1165043215 19:33083636-33083658 CTTTGGGAGGTGAAGGCAGATGG - Intronic
1165156319 19:33790892-33790914 CTTTGGGAGGAGAAGGCAGGAGG + Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165758464 19:38307541-38307563 CTGTGTGAGGACAAGGCCCAAGG + Intronic
1166408948 19:42543487-42543509 CTGGGTCAGGAGCAGGGAGAGGG + Intronic
1166505394 19:43368391-43368413 CTGGCTTAGGGGAAGGCAGAAGG - Intergenic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1167986031 19:53316897-53316919 CTGTGGGAGGCCAAGGCAGAAGG + Intergenic
925425271 2:3744192-3744214 ATGAGAGAGGAGAAGGCAGATGG + Intronic
926063881 2:9821990-9822012 CTGTGTTAGGAGGCCGCACAAGG + Intergenic
926156197 2:10455228-10455250 CTGTCCTACAAGAAGGCAGAAGG - Intergenic
926863457 2:17333789-17333811 CTGTGTTATCACATGGCAGAAGG - Intergenic
927325514 2:21800823-21800845 CTTTGGGAGGACAAGGCAGAAGG - Intergenic
927707805 2:25307707-25307729 CTGTGGGAGGCCAAGGCAGATGG - Intronic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
927976828 2:27345038-27345060 CTTTGAGAGGACAAGGCAGAAGG + Intronic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928047645 2:27953424-27953446 CTGTGGTAGGCCAAGGCAGGAGG - Intronic
928726209 2:34176712-34176734 CTGTGATAGGAGAAGAGAAATGG + Intergenic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
931033486 2:58211103-58211125 CTCTGTTAGGACAATGCGGAAGG - Intronic
931412300 2:62044750-62044772 CTTTGGTAGGTGAAGGGAGAAGG - Intronic
931419756 2:62116088-62116110 CTGTGGAAGGCCAAGGCAGATGG - Intronic
931616864 2:64168064-64168086 CTGTGATAGGAGTAGGCAAATGG - Intergenic
931701478 2:64912798-64912820 CTTTGGGAGGAGAAGGCAGGTGG + Intergenic
932220534 2:69995674-69995696 CTGTGGTGGGAGCAGGAAGAGGG + Intergenic
932433104 2:71687042-71687064 CCGAGTAAGGAGAAGGCAGGGGG - Intergenic
932467109 2:71931005-71931027 TTGTGCTAAGAGAAGGCAGGAGG + Intergenic
932644939 2:73490316-73490338 CTATTTTAGCAGAAGGTAGAAGG + Exonic
933417391 2:82003708-82003730 CAGTGTTAAGTAAAGGCAGATGG + Intergenic
933637352 2:84722408-84722430 CAGAGTTAGGAATAGGCAGAGGG - Intronic
936073949 2:109389909-109389931 CAGATTCAGGAGAAGGCAGATGG - Intronic
936401759 2:112169936-112169958 CTGTTTTAAGAAAAGGAAGAAGG + Intronic
937479470 2:122243568-122243590 CTGTGTTGGGAGAAAGTAGAAGG - Intergenic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
940818078 2:158318876-158318898 CTGTGGGAGGCTAAGGCAGAAGG - Intronic
942014998 2:171804666-171804688 CTTTGGGAGGAGGAGGCAGAAGG + Intronic
942563672 2:177246096-177246118 CTGCCTTGGGAGAAGGCACAGGG - Intronic
942798695 2:179851205-179851227 CTGTGGGAGGACAAGGCAGGAGG + Intronic
943329668 2:186543593-186543615 CTGTGGGAGGCCAAGGCAGATGG - Intergenic
944152979 2:196581821-196581843 CTCTGTGAGGACAAGGCAGGTGG + Intronic
944718911 2:202403439-202403461 CTTTGGAAGGAGAAGGCAGGAGG - Intronic
945631791 2:212287521-212287543 CCCTGTTTGGAGTAGGCAGAGGG - Intronic
946533303 2:220597649-220597671 CTGTGTTATAACATGGCAGAAGG - Intergenic
947169596 2:227298102-227298124 CTTTGGTAGGCCAAGGCAGACGG + Intronic
947205484 2:227657296-227657318 CAGCGTTTGGAGAAGGAAGAAGG + Intergenic
947364262 2:229378069-229378091 CTGACTTTGAAGAAGGCAGAAGG + Intronic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948288608 2:236807495-236807517 CTGTGGGAGGCCAAGGCAGATGG + Intergenic
948863635 2:240764595-240764617 CTGTCTTAGGGGAAAGCAGAGGG - Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170331328 20:15213986-15214008 CTTTGGGAGGACAAGGCAGAAGG - Intronic
1170397691 20:15945910-15945932 GTGTGTCTAGAGAAGGCAGAGGG + Intronic
1172160449 20:32864338-32864360 CTTTGTGAGGTGAAGGCAGGAGG + Intronic
1172366403 20:34353257-34353279 CTGTGTTGGCAAAAGGCTGAGGG - Intergenic
1172962488 20:38808283-38808305 CTGGTTTAGGAGAAGGCAGAAGG + Intronic
1173180538 20:40803426-40803448 CTGTGTTGGGAGTGGGCAGGGGG - Intergenic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173628963 20:44495661-44495683 CTGTGTAAGGAGGGGGCAGGGGG - Intergenic
1174642173 20:52054087-52054109 CTGTGGGAGGCCAAGGCAGAAGG - Intronic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1175476639 20:59280016-59280038 TTCTGCTTGGAGAAGGCAGATGG + Intergenic
1176261847 20:64185992-64186014 CTTCATTAGGAGAAGACAGACGG + Intronic
1176342952 21:5714986-5715008 GGGTGTTAGGTGAAGGCAGCCGG - Intergenic
1176475206 21:7147137-7147159 GGGTGTTAGGTGAAGGCAGCCGG - Intergenic
1176501875 21:7609470-7609492 GGGTGTTAGGTGAAGGCAGCCGG + Intergenic
1176537273 21:8113055-8113077 GGGTGTTAGGTGAAGGCAGCCGG - Intergenic
1178358892 21:31931868-31931890 GTGGGATGGGAGAAGGCAGATGG - Intronic
1179384426 21:40929061-40929083 CTCTGTTAGGGCAATGCAGAAGG - Intergenic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179884747 21:44309071-44309093 CTGAGCTTGGAGGAGGCAGAGGG + Intronic
1180130074 21:45821500-45821522 ATGAGTTAGGGGAAGGCACAGGG - Intronic
1180517817 22:16164440-16164462 CTTTGGGAGGAGAAGGCAGGTGG - Intergenic
1180639651 22:17288146-17288168 CTTTGGTAGGTCAAGGCAGAAGG - Intergenic
1180704750 22:17802400-17802422 TGGTGTTAGGAGAAGGCAAGAGG + Intronic
1181516061 22:23414402-23414424 GTGCTTTAGGAGGAGGCAGAAGG - Intergenic
1181868416 22:25877881-25877903 CTGTGTTAGGAGTGAGCAAACGG - Intronic
1182779749 22:32858247-32858269 ATGTGTTAGGCCAGGGCAGAGGG + Intronic
1182957979 22:34445197-34445219 TGGGGTTAGGAAAAGGCAGAGGG + Intergenic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183519753 22:38290016-38290038 CTGTGTTGGGTAAATGCAGATGG + Intergenic
1184194455 22:42917361-42917383 CTTTGAGAGGACAAGGCAGAAGG + Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184558784 22:45248952-45248974 CTGTGCTAGCAGAAGTCAAAAGG - Intergenic
1184854448 22:47138811-47138833 CCGTGTGAGGACATGGCAGAGGG - Intronic
1185100612 22:48839034-48839056 CTGTGCTAGGAGATGACACAAGG - Intronic
1185189197 22:49423396-49423418 GTGTGTTGGGTGAAGGCAGAGGG + Intronic
1185189206 22:49423448-49423470 GTGTGTTGGGTGAAGGCAGAGGG + Intronic
1203242217 22_KI270733v1_random:29459-29481 GGGTGTTAGGTGAAGGCAGCCGG - Intergenic
949302894 3:2605343-2605365 CAGTGTTAGGAGGTGGGAGAAGG + Intronic
949329423 3:2905415-2905437 CTGTGTTTGCACATGGCAGAAGG + Intronic
949365562 3:3276758-3276780 ATGTGTTTGGAGGAGGGAGAGGG - Intergenic
950104516 3:10379674-10379696 CTGGGTTGAGAGAAGGCAAAGGG + Intronic
950506581 3:13398674-13398696 CTGTGGGAGGCCAAGGCAGAAGG + Intronic
951732860 3:25829809-25829831 CTGTGTTATAACATGGCAGAAGG - Intergenic
951746434 3:25982801-25982823 CTGTGTTCAGAAAAGGCAGATGG - Intergenic
951969690 3:28429980-28430002 CTCTGCTAGGAGAGTGCAGAAGG + Intronic
952268149 3:31806747-31806769 CTGTGTGAGGAGGAGGCATTTGG + Intronic
952422259 3:33142895-33142917 CTGTGGGAGGCCAAGGCAGATGG - Exonic
952841976 3:37654259-37654281 CTGTGGCAGGAGAGGGCTGAAGG + Intronic
953003338 3:38954743-38954765 CTGTGGGAGGCTAAGGCAGATGG + Intergenic
953178471 3:40574145-40574167 CTGAGTCAGGAATAGGCAGAGGG + Intronic
954055113 3:48016694-48016716 CTGTGTTAGAGGAAGGAAGTGGG - Intronic
955393337 3:58536901-58536923 CTGTGTTAGTAGCAGGGAGATGG - Intronic
955566329 3:60250894-60250916 CTGTGTTTGGTGAGGGCAGTGGG - Intronic
956418487 3:69059641-69059663 CCGTGTAGGGAGAATGCAGAGGG + Intronic
956938574 3:74131785-74131807 CTCTGTTAGGGCAGGGCAGAGGG - Intergenic
958069333 3:88589402-88589424 CTGTGTTTGGAGTAACCAGAGGG - Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
959591131 3:108083021-108083043 CTGTTTTATGAGAAGGGAGTAGG - Intronic
960832494 3:121864570-121864592 CTTTGGGAGGACAAGGCAGATGG + Intronic
960919297 3:122730318-122730340 CTGTAATAGAAGAAGCCAGAAGG - Exonic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961048735 3:123728257-123728279 CTTTGGTAGGCCAAGGCAGAAGG + Intronic
961323822 3:126097926-126097948 CTGTGTAAGGGGGAGACAGAGGG - Intronic
961736817 3:129007160-129007182 CTGGGGTAGGAGAATCCAGAAGG - Intronic
962089198 3:132225164-132225186 CTTTGTGAGGCCAAGGCAGAAGG + Intronic
964722208 3:159778797-159778819 CTGTCTCTGGAGAAGACAGATGG + Intronic
964751758 3:160060184-160060206 CTGTGGGAGGCCAAGGCAGAGGG + Intergenic
964918780 3:161870601-161870623 CTGTATTAGGATAAGGTAGAAGG - Intergenic
965101921 3:164309550-164309572 CTCTGTTAGGACAGTGCAGAAGG - Intergenic
965156868 3:165071385-165071407 CTGTGTCAGATGAAGGCAAAAGG - Intronic
965543537 3:169893088-169893110 ATGTGTAAGGACAAGGCATAGGG + Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966327485 3:178773157-178773179 CTGAGTTAGGAGTAGGAAAAAGG + Intronic
966443477 3:179974276-179974298 CTGTGGGAGGAGAAGCCACAGGG + Intronic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967171037 3:186824003-186824025 TTGTGTTAGGAGAGGGCTGAAGG + Intergenic
967953951 3:194862871-194862893 CTGGGAGAGGAGGAGGCAGAGGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
969512334 4:7625893-7625915 CTGTGTAAGGCCAAGGCAGGCGG + Intronic
970306088 4:14733994-14734016 CTCTGCTAGGACAATGCAGAAGG - Intergenic
973667460 4:53177399-53177421 GTGGGTTAGGAGAAGGGAGAGGG + Intronic
973726765 4:53784724-53784746 CTTTGGGAGGCGAAGGCAGAAGG - Intronic
973826390 4:54711122-54711144 CTTTGGGAGGACAAGGCAGAAGG - Intronic
974020268 4:56686906-56686928 CTGTGCTAGTAGAAAGCAGGGGG + Intergenic
974340719 4:60611888-60611910 CTTTGTTAGGTGGAGGCAGGCGG - Intergenic
974859559 4:67503018-67503040 CTGTGTTAGGAGTTGACTGATGG - Intronic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
975485316 4:74928843-74928865 CTCAGTTAGTAGATGGCAGAGGG + Intergenic
975575140 4:75854994-75855016 CTTTGTTAGGCCAAGGCAGGTGG + Intergenic
975641582 4:76505892-76505914 CTTTGGGAGGAGGAGGCAGAAGG - Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975851399 4:78576538-78576560 CTTTGGGAGGACAAGGCAGAAGG - Intronic
978729864 4:112013154-112013176 TTCTTTTAGGAAAAGGCAGAAGG - Intergenic
978808888 4:112829410-112829432 CTTTGGGAGGCGAAGGCAGAAGG + Intronic
980034740 4:127870981-127871003 GTGTATTGGGAGAAGTCAGAAGG + Intergenic
980415427 4:132482755-132482777 CTGTGGTTGGAGAGAGCAGATGG + Intergenic
981991837 4:150930827-150930849 CAGTGTTAGGAGATGACAGCTGG + Intronic
982817179 4:159900523-159900545 CTGTGGGAGGCCAAGGCAGATGG - Intergenic
982987754 4:162232252-162232274 CTCTGTTAGGGAAATGCAGAAGG - Intergenic
983201770 4:164868624-164868646 CTTTGGGAGGACAAGGCAGATGG - Intergenic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
984466598 4:180107416-180107438 CTGTGTTAGGAAAATGGAGAAGG + Intergenic
984469410 4:180147805-180147827 CTGTGAGAGGAGGATGCAGAAGG - Intergenic
984782875 4:183541839-183541861 CTGTGCAAGGGGAATGCAGAAGG - Intergenic
985147876 4:186912965-186912987 CTGTGTTAGGAACAGTCAGTGGG + Intergenic
985159978 4:187034274-187034296 CTCTGCTAGGACAATGCAGAAGG + Intergenic
985746763 5:1652429-1652451 CTGTGGTGGGAGCAGGCAGAGGG - Intergenic
985803584 5:2021999-2022021 CTGTGTTAGGGGGAGGCAAGGGG - Intergenic
986227440 5:5828796-5828818 CTGGGGTGGGAGAAGGCAAAGGG - Intergenic
986301400 5:6481250-6481272 CTGTCTTAGGAGCAGGCTGTGGG - Intronic
986338057 5:6769463-6769485 CTCTGTCAGTAGAATGCAGAGGG + Intergenic
988085905 5:26475506-26475528 CTGTTTTATGAGAAGACAAAGGG - Intergenic
988662354 5:33285658-33285680 CTGTGTTATAACATGGCAGAAGG - Intergenic
988986957 5:36629861-36629883 CTGTGGTCAGAGAAGGCTGATGG - Intronic
990042587 5:51390959-51390981 CTATGGTCTGAGAAGGCAGAGGG + Intronic
990191318 5:53263301-53263323 ATGTGTGAGTAGAAAGCAGAGGG - Intergenic
990504126 5:56427794-56427816 CTGGGGTGGGAGAAGGCAGAGGG - Intergenic
990595576 5:57309513-57309535 CTCTGCTAGGACAATGCAGAAGG + Intergenic
990933872 5:61125630-61125652 CTGTGTATTGACAAGGCAGATGG + Intronic
992341071 5:75823945-75823967 CTGTGGGAGGAGGAGGCAGAAGG + Intergenic
994958950 5:106572935-106572957 CTGTGTTACCACATGGCAGAAGG - Intergenic
995277464 5:110293415-110293437 CTGTGTTATAACATGGCAGAAGG - Intronic
995951351 5:117717976-117717998 CTTTGGGAGGTGAAGGCAGATGG - Intergenic
996179981 5:120407257-120407279 CTGTGCTAGGGCAATGCAGATGG + Intergenic
996343454 5:122464256-122464278 CTGAGATTTGAGAAGGCAGAAGG - Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996854181 5:127986603-127986625 CTGACTTAGGGGAAGGCTGATGG + Intergenic
998042600 5:138961904-138961926 CTGTGTTTGGAGAAGCTAAAAGG - Intronic
998186154 5:139981496-139981518 CTGTGTTAAGAGAAGGGAAACGG - Intronic
998305553 5:141072736-141072758 CTGTGGGAGGACAAGGCAGGAGG + Intergenic
998791694 5:145772523-145772545 CTGTGTTATAACATGGCAGAAGG + Intronic
998906747 5:146913250-146913272 GGATGGTAGGAGAAGGCAGAGGG + Intronic
999103028 5:149043118-149043140 CTGTATTAGAAAAAGGCAGTTGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999690648 5:154143278-154143300 CAGTGTCAGGAGAAGGCTGTGGG - Intronic
1000029367 5:157389121-157389143 CTGTGGTGGGAGGTGGCAGATGG + Intronic
1000130767 5:158295822-158295844 CTTTGTGAGGCCAAGGCAGATGG - Intergenic
1000314708 5:160078573-160078595 CTGTGCTAGTAGAAGGCTGTTGG - Intronic
1000537217 5:162493727-162493749 CTTTGCTGGTAGAAGGCAGAGGG - Intergenic
1000876605 5:166646893-166646915 ATGTCATAGGAGAAAGCAGAAGG - Intergenic
1000990750 5:167908709-167908731 CTGTGTTGGGAAAAGAGAGAAGG - Intronic
1001317094 5:170651326-170651348 CTGTATCAGGGGAAGGCAGGTGG + Intronic
1001381794 5:171310501-171310523 GTGTGTTTGGGGGAGGCAGAGGG - Intronic
1001547613 5:172580205-172580227 GTGTCTGAGGAGTAGGCAGAAGG - Intergenic
1002397314 5:178968153-178968175 TTGTGGTAGGAAAAGGGAGAGGG - Intergenic
1002936600 6:1679136-1679158 CTGTGTTGAGAGCAGACAGATGG + Intronic
1003595351 6:7469534-7469556 CTTTGGGAGGAGAAGGCAGGAGG - Intergenic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004834586 6:19516405-19516427 CTCTGTTAGGACAGTGCAGAAGG + Intergenic
1005073727 6:21887067-21887089 ATGAGTTAGGAGAAAGCAGTGGG + Intergenic
1005410668 6:25542285-25542307 CTTTCTTAGGAAAGGGCAGAAGG + Intronic
1005676477 6:28160712-28160734 CTTTGGTAGGCCAAGGCAGAAGG + Intergenic
1005834748 6:29699873-29699895 CTTTGGTAGGCTAAGGCAGAAGG - Intergenic
1006173829 6:32110032-32110054 CTGAGGTAGGAGAATGCAAAGGG - Intronic
1006254744 6:32821721-32821743 ATGTGTTAGGAGGAAGTAGAAGG - Intronic
1006375541 6:33669866-33669888 GTCTGTGAGGAGGAGGCAGAGGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006644692 6:35508062-35508084 CTTTGGGAGGAGGAGGCAGATGG - Intronic
1007093639 6:39200076-39200098 CTGGGTTAGGGGAAGGGACATGG + Intronic
1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG + Intergenic
1007556688 6:42772326-42772348 CTGAGTTAGGCGACGGGAGAAGG + Intronic
1008053816 6:46926438-46926460 CTCTTCTAGGAGATGGCAGAGGG - Intronic
1008336693 6:50314671-50314693 CTGTGGGAGGAGAAAGCAGTGGG + Intergenic
1009196392 6:60691551-60691573 CTGTGTTAGGAACAGCCTGAAGG + Intergenic
1009908634 6:69899394-69899416 CTGTGGGAGGCCAAGGCAGATGG - Intronic
1010197972 6:73258842-73258864 GTGTCTTAGGGAAAGGCAGAAGG - Intronic
1010214976 6:73393595-73393617 CTGTGTGAGGCCAAGGCAGGAGG + Intronic
1010254277 6:73740120-73740142 CTTTGTGAGGCCAAGGCAGAAGG - Intronic
1010740896 6:79503123-79503145 CTTTGATAGGCCAAGGCAGATGG - Intronic
1010769272 6:79810130-79810152 CTGTGTGAGCTTAAGGCAGAAGG + Intergenic
1010785166 6:79992375-79992397 CTTTGTGAGGCCAAGGCAGATGG - Intergenic
1011339274 6:86294755-86294777 CTGTGTGTAGAGAAGTCAGAAGG - Intergenic
1011469826 6:87697063-87697085 CTGTGTGAGGCCAAGGCAGTTGG + Intronic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1012447984 6:99326288-99326310 CTGGGTGAGGCAAAGGCAGAAGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013844296 6:114430868-114430890 CTGTGTCAAGACATGGCAGAAGG - Intergenic
1014788223 6:125642018-125642040 GATTCTTAGGAGAAGGCAGAAGG + Intergenic
1015036937 6:128667431-128667453 CTGTGGTAGTTGAAGGTAGAGGG + Intergenic
1015149970 6:130026069-130026091 CTGTGATAGGACCCGGCAGATGG + Intronic
1015240758 6:131021039-131021061 CTGTGGGAGGCCAAGGCAGAAGG - Intronic
1016301809 6:142640125-142640147 ATGTGATTGGGGAAGGCAGATGG + Intergenic
1018742663 6:166742513-166742535 TTGTGTCAGGAGGAGGCAGAAGG - Intronic
1019173597 6:170148451-170148473 ACGTGTTGGTAGAAGGCAGAAGG - Intergenic
1019670941 7:2278000-2278022 GTGTGACAGGAGAAGGCTGAAGG - Intronic
1020641512 7:10759705-10759727 GTGGCTTAGGAGAAGGGAGAAGG + Intergenic
1021240858 7:18199540-18199562 CTTTGGTAGGCCAAGGCAGAAGG + Intronic
1021809466 7:24389441-24389463 TTGTGTTGGGAGAAGGGGGAAGG - Intergenic
1024192007 7:47021777-47021799 CGGTGATAGTAGAAGACAGAGGG + Intergenic
1024550535 7:50559269-50559291 CTGTGTTGAGAGACAGCAGAGGG - Intronic
1024799504 7:53059715-53059737 CTCAGTAAGGAAAAGGCAGAGGG - Intergenic
1024810665 7:53207631-53207653 CTGGGATAAGAGATGGCAGATGG + Intergenic
1025061309 7:55810941-55810963 CTGTACAAGGAAAAGGCAGAAGG - Intronic
1025221601 7:57115038-57115060 CTGTGCTAGGGCAATGCAGAAGG - Intergenic
1025267367 7:57474754-57474776 CTGTGATAGGACAATGCTGAAGG + Intergenic
1025632384 7:63286706-63286728 CTGTGCTAGGGCAATGCAGAAGG - Intergenic
1025650177 7:63459527-63459549 CTGTGCTAGGGCAATGCAGAAGG + Intergenic
1025862373 7:65343195-65343217 CTTTGTGAGGCCAAGGCAGAAGG - Intergenic
1026557371 7:71420170-71420192 CTGGCTTAGGAGACAGCAGATGG - Intronic
1028582669 7:92423395-92423417 CTGGGTTTGGAGATGCCAGAGGG - Intergenic
1028839873 7:95417339-95417361 CTTTCTGAGGAGCAGGCAGATGG - Intronic
1029437664 7:100572123-100572145 CTGTGTTAGGCGGAGGGCGAGGG - Intergenic
1030038580 7:105429777-105429799 CTGTGTGAGGCCAAGGCAGGAGG - Intergenic
1030580312 7:111346956-111346978 CTGTGATAATAGATGGCAGAGGG + Intronic
1030618087 7:111759562-111759584 CAGTTTCAGGAAAAGGCAGAGGG + Intronic
1031157967 7:118133573-118133595 TTGTGGTAGGAGTAGGGAGATGG - Intergenic
1031221518 7:118972481-118972503 CTTTGGGAGGACAAGGCAGACGG - Intergenic
1032434287 7:131887560-131887582 TTGTGTTAGGAGCAGGGTGAGGG - Intergenic
1033564497 7:142565437-142565459 CTGGATTAGTAGCAGGCAGAAGG - Intergenic
1034421297 7:150992458-150992480 CTGTCTCAGGAGGAGGGAGATGG - Intronic
1034559717 7:151872233-151872255 CTGTGATGAGAGAATGCAGAAGG - Intronic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1035052161 7:156005212-156005234 CTGTCTTAGGATAAGTCATAGGG - Intergenic
1035197331 7:157232593-157232615 CTTTGGTAGGACAAGGCAGGTGG - Intronic
1035587478 8:786944-786966 CTCTTTCAGGTGAAGGCAGAAGG + Intergenic
1035985538 8:4427341-4427363 CTGTGTCAGGACACGGCAGAGGG + Intronic
1037128134 8:15374554-15374576 CTGTGTTAAAAGAAAGCACAGGG - Intergenic
1037763636 8:21758324-21758346 CTCTGTTGGGAGGTGGCAGAGGG - Intronic
1037946312 8:22991698-22991720 CTGTGTACCAAGAAGGCAGAGGG + Intronic
1037991332 8:23323308-23323330 CTATGTTAGGAAAGAGCAGAAGG + Intronic
1038494259 8:27990467-27990489 CTGTGTTGGGGGTAGGCTGATGG + Intronic
1040584202 8:48725094-48725116 CTGTGGTAGGGAAAGGCACATGG + Intronic
1042225907 8:66514146-66514168 CTGTCTTGGTACAAGGCAGAAGG - Intronic
1043320197 8:78975157-78975179 CTGTGTCCTGACAAGGCAGAAGG + Intergenic
1043357423 8:79429303-79429325 CTGTGTCATCACAAGGCAGAAGG - Intergenic
1045268072 8:100637649-100637671 CTGTGTTAGGAATAGACTGAAGG - Intronic
1045746659 8:105430757-105430779 CTGAGTTAGAAGGAGGCTGATGG + Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1045845522 8:106630905-106630927 CTGTGCTAGCTGAGGGCAGAAGG + Intronic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1047073535 8:121374791-121374813 ATGTGATAGAAGAAGGCAGGAGG + Intergenic
1047553947 8:125908611-125908633 CTTTGGGAGGACAAGGCAGAAGG - Intergenic
1047668250 8:127116192-127116214 GTGTGTTTGGAGAAGGCTGAGGG + Intergenic
1047715862 8:127594586-127594608 CTGTGTTCAGAGAAGGTTGAAGG + Intergenic
1047732186 8:127736816-127736838 ATGGGAGAGGAGAAGGCAGAGGG + Intronic
1047795530 8:128251416-128251438 CTATTTAAGGAGAAAGCAGAAGG - Intergenic
1048317009 8:133369992-133370014 CAGTGTGAGGGGCAGGCAGAGGG - Intergenic
1048744250 8:137595773-137595795 CTGTCTTTGGAGAAGGGAGGTGG + Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1048919268 8:139213225-139213247 CTGTGTTATGAGATGAAAGAAGG - Intergenic
1049534622 8:143172761-143172783 ATGTGTTGGGAGAAGCCACAGGG - Intergenic
1050191025 9:3026478-3026500 CTGTGTAAGGAAAGTGCAGATGG - Intergenic
1052858312 9:33421001-33421023 CTGTGGGAGGCCAAGGCAGATGG + Intergenic
1053218476 9:36292429-36292451 CAATGTTAGGAGAAGGATGAAGG - Intronic
1053254300 9:36602800-36602822 CTTTGGTAGGCCAAGGCAGACGG - Intronic
1053378508 9:37628953-37628975 CTGTGGGAGGCCAAGGCAGACGG + Intronic
1053796795 9:41733929-41733951 CTTTGGTAGGCCAAGGCAGATGG + Intergenic
1053829638 9:42064317-42064339 CTGTGTCATAACAAGGCAGAAGG + Intronic
1053892965 9:42713826-42713848 CTTTGGGAGGCGAAGGCAGACGG - Intergenic
1054600923 9:67123137-67123159 CTGTGTCATAACAAGGCAGAAGG - Intergenic
1055355157 9:75429877-75429899 CTGGGATAGGAAAAGGCAGAGGG + Intergenic
1055413446 9:76056394-76056416 CCGTGTGAGGAGAGGGCAAAAGG + Intronic
1055604459 9:77953857-77953879 CTGTGCTGGCAGCAGGCAGAAGG - Intronic
1055794088 9:79955423-79955445 CTCTGTTAGGGGAACGCAGAAGG + Intergenic
1056089054 9:83186568-83186590 CAGTGTTTGCAGCAGGCAGAAGG - Intergenic
1056133810 9:83610771-83610793 CTTTGGGAGGACAAGGCAGAAGG - Intergenic
1056333262 9:85539520-85539542 CTGTGTAATGAAAAGGCAGGGGG + Intergenic
1056879555 9:90378382-90378404 CTTTGTTAGGCCAAGGCAGGTGG + Intergenic
1056989888 9:91400885-91400907 CTTTGAAAGGACAAGGCAGAAGG - Intergenic
1058037609 9:100270365-100270387 CTTTGGTAGGCCAAGGCAGAAGG + Intronic
1058682525 9:107452476-107452498 CTTTGGTAGGTCAAGGCAGACGG + Intergenic
1058775576 9:108280071-108280093 CTGTGTTAAGAACAGGCTGAAGG + Intergenic
1059816358 9:117920103-117920125 CTCTGTTAGGAAAATGCAGCTGG + Intergenic
1060477484 9:123997367-123997389 CTCTGTAAGGAGGAGGCAAAGGG - Intergenic
1060610377 9:124958661-124958683 CTTTGGGAGGTGAAGGCAGAGGG + Intronic
1060671224 9:125471451-125471473 AAGAGTTAGGAGTAGGCAGATGG + Intronic
1061337017 9:129945922-129945944 CTGTGGGAGGCCAAGGCAGACGG + Intronic
1061679546 9:132236177-132236199 CTGTGGTGGGTGAAGGGAGAAGG + Intronic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1203458545 Un_GL000220v1:12536-12558 GGGTGTTAGGTGAAGGCAGCCGG - Intergenic
1186082954 X:5953125-5953147 CTGTGGGAGGACAAGGCAGGGGG + Intronic
1186140665 X:6568477-6568499 CTGTGTTAGGAGGAGAAAGCAGG + Intergenic
1187013323 X:15302101-15302123 CTGTGTCATGAGATGGCAGCTGG - Intronic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187695285 X:21913254-21913276 CTTTGGTAGGCCAAGGCAGAAGG + Intergenic
1189288038 X:39866067-39866089 CTGGCTTGGGAGAAGGCACAGGG - Intergenic
1189532758 X:41903267-41903289 TAGTGTTGGGAGACGGCAGAAGG + Intronic
1190018122 X:46846342-46846364 CTTTGGGAGGTGAAGGCAGAAGG + Intronic
1190470272 X:50771534-50771556 ATGGGCTAGAAGAAGGCAGAAGG - Intronic
1191084035 X:56545554-56545576 CTGTGTTAGGGCAGTGCAGAAGG - Intergenic
1193876720 X:86870226-86870248 CTTTGTTAGGCCGAGGCAGATGG - Intergenic
1195222264 X:102756584-102756606 CAGTGTTAGGAATATGCAGAAGG - Intergenic
1196031509 X:111098638-111098660 CTGGGTAAGGAGAGGGCAGTGGG + Intronic
1196327778 X:114428537-114428559 CTTTGTGAGGACAAGGCAGGAGG + Intergenic
1196505017 X:116431710-116431732 CTGTGGCAGGAAAAGACAGAAGG - Intergenic
1196744408 X:119056558-119056580 CTTTGTTAGAGGCAGGCAGATGG + Intergenic
1196774610 X:119326929-119326951 CAGTGTTTGGCCAAGGCAGAGGG - Intergenic
1198393932 X:136204674-136204696 GTGTGTCAGCAGGAGGCAGAAGG + Intronic
1198556695 X:137801205-137801227 CTGGGTAATGAGAAGGCATAGGG - Intergenic
1198588680 X:138150823-138150845 CTGTGTTATAACACGGCAGAAGG - Intergenic
1199322232 X:146454048-146454070 ATGTGTTATATGAAGGCAGAGGG - Intergenic
1199833553 X:151566389-151566411 CTCTGGAAGGAGAAGGCAGAGGG + Intronic
1199860253 X:151795014-151795036 ATCTGTTAGGAGATGGGAGAAGG - Intergenic
1200259241 X:154603411-154603433 CTGTGGGAGGCTAAGGCAGAAGG - Intergenic
1201189234 Y:11432253-11432275 CTGTGGGAGGACAAGGCAGGTGG - Intergenic