ID: 1165312769

View in Genome Browser
Species Human (GRCh38)
Location 19:35038995-35039017
Sequence CAGTGCATACACCAGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 195}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165312760_1165312769 13 Left 1165312760 19:35038959-35038981 CCACCAGGCCTACCCAAGGCTGG 0: 1
1: 0
2: 3
3: 31
4: 336
Right 1165312769 19:35038995-35039017 CAGTGCATACACCAGGCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 195
1165312757_1165312769 16 Left 1165312757 19:35038956-35038978 CCCCCACCAGGCCTACCCAAGGC 0: 1
1: 0
2: 0
3: 15
4: 259
Right 1165312769 19:35038995-35039017 CAGTGCATACACCAGGCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 195
1165312759_1165312769 14 Left 1165312759 19:35038958-35038980 CCCACCAGGCCTACCCAAGGCTG 0: 1
1: 0
2: 3
3: 18
4: 197
Right 1165312769 19:35038995-35039017 CAGTGCATACACCAGGCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 195
1165312758_1165312769 15 Left 1165312758 19:35038957-35038979 CCCCACCAGGCCTACCCAAGGCT 0: 1
1: 0
2: 2
3: 34
4: 301
Right 1165312769 19:35038995-35039017 CAGTGCATACACCAGGCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 195
1165312764_1165312769 5 Left 1165312764 19:35038967-35038989 CCTACCCAAGGCTGGGTATTAAT 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1165312769 19:35038995-35039017 CAGTGCATACACCAGGCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 195
1165312763_1165312769 10 Left 1165312763 19:35038962-35038984 CCAGGCCTACCCAAGGCTGGGTA 0: 1
1: 0
2: 3
3: 12
4: 163
Right 1165312769 19:35038995-35039017 CAGTGCATACACCAGGCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 195
1165312765_1165312769 1 Left 1165312765 19:35038971-35038993 CCCAAGGCTGGGTATTAATAATC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1165312769 19:35038995-35039017 CAGTGCATACACCAGGCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 195
1165312766_1165312769 0 Left 1165312766 19:35038972-35038994 CCAAGGCTGGGTATTAATAATCA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1165312769 19:35038995-35039017 CAGTGCATACACCAGGCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165312769 Original CRISPR CAGTGCATACACCAGGCCCA GGG Intronic
900211119 1:1456362-1456384 CACAGCATGCACCAGGCCCTTGG + Intronic
900216945 1:1486681-1486703 CACAGCATGCACCAGGCCCTTGG + Intronic
900224027 1:1524410-1524432 CACAGCATGCACCAGGCCCTTGG + Intronic
900647556 1:3715785-3715807 CAGTGCATAGTGAAGGCCCAGGG - Intronic
902049533 1:13551827-13551849 AAGTGCATATACCAATCCCAGGG + Intergenic
902359422 1:15934222-15934244 CAGGGCATTCACCGGGACCAGGG - Exonic
904751547 1:32743645-32743667 CAGTGTATACTCCAGGGCAATGG + Intronic
904889804 1:33771255-33771277 CATTGCAGAGACCAAGCCCAGGG - Intronic
905156612 1:35988992-35989014 CAGTGCATATACCACGTACAAGG - Intronic
905392883 1:37649343-37649365 CAGTGACTACACAAGTCCCATGG - Intergenic
905393527 1:37652997-37653019 TAGTGCAGAGGCCAGGCCCAAGG - Intergenic
906034707 1:42742902-42742924 CAATGGAGAAACCAGGCCCAGGG - Intergenic
907393809 1:54176173-54176195 CAGGGCTTACACCAGCACCACGG - Intronic
907500491 1:54876000-54876022 CAGGGCAGTCACCTGGCCCATGG + Exonic
912203462 1:107484174-107484196 CAGTGAACACTCCAGGCCCCAGG - Intergenic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
914826637 1:151142308-151142330 AAGTGAAGAAACCAGGCCCAGGG + Intronic
914900215 1:151707591-151707613 CAGTGCCTACCTCAGCCCCATGG - Exonic
915578131 1:156794934-156794956 TAGTGCATACTCCAGTACCATGG - Intronic
916684533 1:167132599-167132621 CAGTGCACACTCCAAGGCCAGGG + Intergenic
918413869 1:184287641-184287663 CAGTGCCTTCTCCATGCCCAGGG - Intergenic
919763133 1:201110855-201110877 CAGAGGGTACCCCAGGCCCATGG + Intronic
919943568 1:202304518-202304540 CAGAGCTGGCACCAGGCCCAGGG - Intronic
920035239 1:203061057-203061079 CAGTCCCAACCCCAGGCCCAGGG - Intronic
920259623 1:204680009-204680031 CAGAGCACCCTCCAGGCCCAAGG + Intronic
920560060 1:206932505-206932527 CACTGCCAGCACCAGGCCCAGGG + Exonic
920669567 1:207992808-207992830 CAGGGCCTACACGAGGCCCAGGG - Intergenic
1063178420 10:3572778-3572800 CAGTGCATAATCCAAGTCCATGG + Intergenic
1063726760 10:8645565-8645587 CAGTGCATACATGGTGCCCAAGG + Intergenic
1066704684 10:38165032-38165054 CAGTGCATTCAGCTGGCTCAAGG + Intergenic
1066985889 10:42466161-42466183 CAGTGCATTCAGCTGGCTCAAGG - Intergenic
1067221765 10:44348992-44349014 CAGTGCCTACATCAGGCCCCAGG + Intergenic
1067348808 10:45457134-45457156 CAGTGCACACACCCCGGCCAGGG + Exonic
1067434058 10:46264933-46264955 CAGTGCCCCCACCAGGCCCAGGG - Intergenic
1067901730 10:50248769-50248791 CATTCCATAGACCAAGCCCATGG + Intergenic
1068148090 10:53097321-53097343 CATTTCATAGGCCAGGCCCAGGG + Intergenic
1069821003 10:71228768-71228790 CAATGCATACACAATGGCCAAGG - Intronic
1069863693 10:71487001-71487023 CAGAGCATATGCCTGGCCCAGGG - Intronic
1069865282 10:71498562-71498584 CAGTGCCTACAGCAGTACCAGGG + Intronic
1069868174 10:71517021-71517043 CAGTCCATACGCCAGGCCTGGGG - Intronic
1070502200 10:77082665-77082687 CAGTGGCTACACCAGGATCAGGG - Intronic
1070947687 10:80407226-80407248 CAGTGCAAAGACCAGTCACAGGG - Intergenic
1070949012 10:80415881-80415903 CAGTGCATTCACAAAGTCCAGGG - Intronic
1071247367 10:83779626-83779648 CTGTACATACTCCAGGTCCAGGG - Intergenic
1073464810 10:103688350-103688372 CAGGGCTTGCACCAGCCCCAGGG - Intronic
1074408568 10:113202317-113202339 CAGTGGTTACAGCAGGCCCCAGG + Intergenic
1075793834 10:125104929-125104951 CTGTGAAAACACCAGGCCCGAGG + Intronic
1076775778 10:132697286-132697308 CAGTGGATAGGCCAGGCCCAGGG - Intronic
1078366319 11:10709371-10709393 CAGTGACTACAGCATGCCCAAGG + Intergenic
1080689877 11:34547627-34547649 CAGAGCAAAGACCAGGCCAAAGG - Intergenic
1081245783 11:40764599-40764621 CAGTGTTTACTCAAGGCCCAAGG - Intronic
1083324320 11:61865775-61865797 CAGTGCATACACCAGCCTCTCGG - Exonic
1084607502 11:70181071-70181093 CAGTACATACTTCAAGCCCAAGG + Intronic
1085058636 11:73424430-73424452 CAGTGTGGACTCCAGGCCCAAGG - Intronic
1086413927 11:86570073-86570095 GAGTTCATGCACCTGGCCCACGG + Intronic
1087718566 11:101636563-101636585 CAGTGCATACACTCTGCCAAGGG + Intronic
1090508176 11:127342104-127342126 CATTACATGCACCAGGCCCTGGG - Intergenic
1093091690 12:14928518-14928540 CAGTGCATATAGCAGGCACTCGG - Intronic
1093171858 12:15870300-15870322 CAGTGAAGTCAGCAGGCCCAGGG + Intronic
1094855161 12:34399616-34399638 CTGTGCATGCACAGGGCCCAGGG + Intergenic
1096993025 12:55820417-55820439 CAGTGCCTTCCCCATGCCCATGG - Exonic
1098096632 12:66963939-66963961 CAGTGCCTACACCAGGAACCTGG + Intergenic
1103446744 12:120999719-120999741 CTGTGCATGCAGCAGGCCTAGGG + Intronic
1103850211 12:123928188-123928210 CAGTGCACCCACGGGGCCCATGG + Exonic
1105256163 13:18745113-18745135 CAGGGGATTCTCCAGGCCCATGG + Intergenic
1108359978 13:49660050-49660072 CAGCACATAGACCAGGCCCTTGG - Intergenic
1108551365 13:51548943-51548965 AAGTGCATACAGCAAGCCCTGGG + Intergenic
1109189939 13:59312147-59312169 CAGGGCATTCAGTAGGCCCAAGG + Intergenic
1109478759 13:62919738-62919760 CAGAGCAGACACCAGGAGCAGGG + Intergenic
1111303368 13:86373668-86373690 CAGTGTTTACTCAAGGCCCAAGG + Intergenic
1114769328 14:25410654-25410676 CAGTGTATACGCCAAGACCAAGG + Intergenic
1117089367 14:52234946-52234968 CAGTGCTTACACAAACCCCATGG + Intergenic
1118455700 14:65944204-65944226 TAGTCCATGCACCAGTCCCAGGG - Intergenic
1122902295 14:104786903-104786925 CTCTGCATTCTCCAGGCCCAGGG + Intronic
1123006038 14:105324367-105324389 CAGTGCTTTCCCCAGGACCAGGG + Intronic
1202835849 14_GL000009v2_random:76915-76937 CAGGGGATGCTCCAGGCCCATGG - Intergenic
1124055853 15:26240488-26240510 CAGGCCCCACACCAGGCCCACGG - Intergenic
1124156172 15:27226677-27226699 CAGTGCATTCACCAGGTCTCTGG + Intronic
1124936933 15:34181986-34182008 CAGTGCCTACACCTGGCATATGG - Intronic
1127033987 15:54895058-54895080 CAGTGAATACACCAGGCCTGGGG - Intergenic
1127137840 15:55943390-55943412 GATTTCATAGACCAGGCCCAGGG + Intronic
1127187504 15:56494586-56494608 CACTGCAGGCTCCAGGCCCAGGG - Intergenic
1129452159 15:75657242-75657264 CACTGCAGTGACCAGGCCCAGGG - Exonic
1130788663 15:87127990-87128012 CAGTACATACACCAGCCCCCGGG - Intergenic
1133257105 16:4523787-4523809 CAGTGAGTACACAAGGCCTAAGG + Intronic
1134055637 16:11168205-11168227 CACTGCAGACACCAGGCCCTGGG - Intronic
1135112289 16:19699627-19699649 CTGTGCAGACACCAGGACCATGG + Exonic
1139483988 16:67246188-67246210 CAGGGAAGACCCCAGGCCCAAGG + Intronic
1141167189 16:81668616-81668638 CAGCGCCTGCACCAGGCCCCCGG - Intronic
1143130721 17:4675282-4675304 GAGTGCAGACAGCAGGTCCAAGG + Exonic
1144726984 17:17506975-17506997 CAGAGCATACAGCAGGCCCAAGG + Intronic
1145975483 17:28981588-28981610 CAGTGCCCACCCTAGGCCCAGGG - Exonic
1147699150 17:42381076-42381098 AAGTGAAAACAACAGGCCCAAGG + Intronic
1148015662 17:44520234-44520256 CTGTCCCTACACCAGACCCATGG - Intergenic
1148700815 17:49585709-49585731 GAGTGCATGAACCAGGCCCTTGG + Intergenic
1149041461 17:52194396-52194418 CAGTGCATGCACCTGGCCTTGGG + Intergenic
1149536411 17:57436986-57437008 CAATGCACACACCAGGCTCCAGG - Intronic
1150706069 17:67488438-67488460 CACAGCACACACCAGGCCCCTGG - Intronic
1152760935 17:82106706-82106728 CAGTGCAGAGTCCTGGCCCAAGG - Intronic
1152805085 17:82351904-82351926 CAGTCCAGAGACCAGGCCAATGG + Intergenic
1153466859 18:5397604-5397626 AAGTGCATGCACCAGGGGCAGGG - Intronic
1156620864 18:38849987-38850009 CAGTGCTTTCAAAAGGCCCAAGG - Intergenic
1157149423 18:45201242-45201264 GAGTGCATACAGCATGCTCAGGG - Intergenic
1157574068 18:48732118-48732140 CAGTGCATTCACCTGGCCGCCGG + Intronic
1160889440 19:1369445-1369467 CAGGGAATGCCCCAGGCCCACGG - Intronic
1161009612 19:1953990-1954012 CACTGCAGACACCAGACCAAGGG - Intronic
1161217758 19:3102976-3102998 CAGTGCACACACCGGGAGCAAGG - Intronic
1162737453 19:12754503-12754525 CAGTGGGGACACCAGGGCCAGGG - Intronic
1162830538 19:13281853-13281875 CAGTGCTCAGACCAGGCCCCAGG - Intronic
1162997157 19:14343438-14343460 CTGTGGATGCTCCAGGCCCAGGG - Intergenic
1164512801 19:28911443-28911465 CAGTGCCCACACCAGCCCCCAGG + Intergenic
1165312769 19:35038995-35039017 CAGTGCATACACCAGGCCCAGGG + Intronic
1166049295 19:40248529-40248551 CAGTGCCTAGAACAGGCCCTTGG + Intronic
1166461492 19:42992037-42992059 CGGTGCAGACACCCGTCCCAAGG + Intronic
1167441600 19:49512584-49512606 CAGGGCACACCCCAGGCCCTAGG - Exonic
1168720237 19:58550748-58550770 CAGTCAATAAACCAGGCCCCAGG - Intergenic
1202636788 1_KI270706v1_random:50448-50470 CAGGGGATGCTCCAGGCCCATGG + Intergenic
925640293 2:5980775-5980797 CAGTGCACACTCCAGGCCTGTGG + Intergenic
926301407 2:11606104-11606126 CCATGCATACTCCAGTCCCATGG + Intronic
928589062 2:32794968-32794990 CAGTGAATCCATCAGGTCCACGG - Intronic
929923082 2:46187199-46187221 CCGTGCAAACACTAGGCCCTCGG - Exonic
930822915 2:55665684-55665706 CACTGCATAAACCATGCCCTGGG - Intronic
932459367 2:71872562-71872584 AAGTGCAAACACCGGGCCGAGGG - Intergenic
935170544 2:100608307-100608329 CAGGGCACAGACCAGGCCCCCGG - Intergenic
938279071 2:130051893-130051915 CAGGGGATGCTCCAGGCCCATGG + Intergenic
938330055 2:130442769-130442791 CAGGGGATGCTCCAGGCCCATGG + Intergenic
938359890 2:130678734-130678756 CAGGGGATGCTCCAGGCCCATGG - Intergenic
938436299 2:131285455-131285477 CAGGGGATGCTCCAGGCCCATGG - Intronic
945471976 2:210237800-210237822 CAGTGGATCCACTAGGTCCATGG - Intergenic
1171490964 20:25516859-25516881 CAGTGCACACACAAGGGCCCAGG + Intronic
1171880901 20:30616864-30616886 CAGGGGATGCTCCAGGCCCATGG + Intergenic
1172223941 20:33291737-33291759 CACTGCCTACACCTGGCTCAGGG + Intronic
1172600992 20:36182903-36182925 CTGTGCACACATCAGGCACATGG + Intronic
1172752680 20:37261793-37261815 CAGAGCAAACACCCAGCCCAGGG - Exonic
1175726565 20:61322539-61322561 CACTGCACACACCAGGACCCAGG - Intronic
1176842166 21:13850137-13850159 CAGGGGATTCTCCAGGCCCATGG + Intergenic
1177861161 21:26455972-26455994 CAGAGAATACAGCAGGCCCATGG - Intergenic
1179590877 21:42407122-42407144 CAGAGCAGAGAACAGGCCCATGG - Intronic
1180364083 22:11923865-11923887 CAGGGGATGCTCCAGGCCCATGG - Intergenic
1180905313 22:19406481-19406503 CACTGCCTCCACCAGGCCCCAGG - Intronic
1183919389 22:41152473-41152495 CAATGAAGAGACCAGGCCCAGGG - Intronic
1184614921 22:45631507-45631529 AAAAGCCTACACCAGGCCCAGGG + Intergenic
950737701 3:15023644-15023666 CAGTACACACAAAAGGCCCAAGG + Intronic
953824747 3:46241425-46241447 CAGCACATACAGCAGGCACATGG + Intronic
958986378 3:100783867-100783889 CCATGCACACACCAGGCCAAGGG - Intronic
963168010 3:142225058-142225080 CAGGTCATACACCGGGCCCCTGG + Intronic
969231494 4:5834942-5834964 CAATGGATACTCCAGGGCCATGG + Intronic
972104057 4:35461097-35461119 GAGTGGTTACAGCAGGCCCAGGG - Intergenic
973394016 4:49578617-49578639 CAGGGGATGCTCCAGGCCCATGG - Intergenic
974818174 4:67032980-67033002 CAGTGCACACACCAGGGGCTCGG + Intergenic
1202764103 4_GL000008v2_random:136319-136341 CAGGGGATGCTCCAGGCCCATGG + Intergenic
986269318 5:6217492-6217514 CAGTGCATACAGCGGGTGCATGG - Intergenic
989515368 5:42337220-42337242 CAGGACATTCTCCAGGCCCAAGG - Intergenic
990292776 5:54370860-54370882 CAGTGAAGCCACCAGGTCCAGGG + Intergenic
997303677 5:132823933-132823955 CAGTCCATCCAGCAGGCCCAGGG + Exonic
999141135 5:149362879-149362901 CAGTGCTGTCACCAGCCCCAGGG - Intronic
999841990 5:155437876-155437898 GAGTGCATAGACCAGGCCTGGGG + Intergenic
1002088513 5:176791009-176791031 CAGTTCTTCAACCAGGCCCACGG + Intergenic
1002104521 5:176873526-176873548 CAGTGCCTAGACCAGGAGCAGGG - Intronic
1002212386 5:177606722-177606744 CAGTGACTGCACAAGGCCCAAGG - Intronic
1002692457 5:181059700-181059722 CTGTGCGTACTTCAGGCCCAGGG + Exonic
1003145178 6:3504413-3504435 CACTGCATACCCCAGACACAGGG + Intergenic
1006562900 6:34928913-34928935 CAGTGTTCAAACCAGGCCCATGG - Intronic
1007939964 6:45771471-45771493 CAGGGCAGCCTCCAGGCCCAGGG + Intergenic
1010526809 6:76910869-76910891 CAGTGAATTCAACAGGTCCAGGG - Intergenic
1010772811 6:79851475-79851497 CAGTGAATCCATCAGGCCCTGGG - Intergenic
1010800879 6:80174427-80174449 CAGAGCATACTCAAGTCCCATGG + Intronic
1012931085 6:105317623-105317645 CATTCCAAACACCAGGCCCAAGG + Intronic
1017580840 6:155863554-155863576 CTGTGAATCCATCAGGCCCAGGG - Intergenic
1019712971 7:2525760-2525782 CAGGGCACTCACCTGGCCCACGG - Exonic
1021817976 7:24466843-24466865 CAGGCCATACCCCAGACCCACGG - Intergenic
1022102689 7:27177953-27177975 CAAAGTAAACACCAGGCCCATGG + Intronic
1022811165 7:33870279-33870301 CAGTGCATTCATCACTCCCAGGG + Intergenic
1023529719 7:41139689-41139711 CAGGGCATACACAAAGCCCCTGG - Intergenic
1024621858 7:51166484-51166506 CAGTGAAGACACCAGGCCTCAGG - Intronic
1025734284 7:64133232-64133254 CAGAGTATCCAACAGGCCCATGG - Intronic
1031275457 7:119715453-119715475 CAGTGATTACATCAGGTCCAGGG - Intergenic
1032027935 7:128457997-128458019 CACAGCATACACCAGACCCCGGG - Exonic
1032917968 7:136512377-136512399 CATGGCATAGACGAGGCCCAGGG - Intergenic
1033407621 7:141085706-141085728 CTGTGAATACTCCAGGCCCTTGG - Intronic
1034492213 7:151399457-151399479 CAGTGCAGCTGCCAGGCCCAGGG + Intronic
1034493815 7:151408720-151408742 CAGTGCATGGGACAGGCCCAGGG + Intronic
1035292824 7:157850472-157850494 TGGTGCACACACCAGGCCCCGGG - Intronic
1039913560 8:41843504-41843526 CAGCACATACAGCAGGCACATGG + Intronic
1047001348 8:120575937-120575959 AAGGGCAAACACCAGGCCAAGGG - Intronic
1048962558 8:139593003-139593025 CACTTCATACACCAGACCTATGG + Intergenic
1049432860 8:142573392-142573414 CAGTGAACACACCAGGCACCTGG + Intergenic
1053147057 9:35718961-35718983 CTGTGCATATCACAGGCCCACGG + Intronic
1053179757 9:35958445-35958467 CAGAGCATATCCCTGGCCCAAGG + Intergenic
1055985853 9:82056215-82056237 CAGGGGATGCTCCAGGCCCATGG - Intergenic
1056585484 9:87924903-87924925 CAGGGGATGCTCCAGGCCCATGG + Intergenic
1056936496 9:90919083-90919105 GAGTCCACACTCCAGGCCCAGGG - Intergenic
1057867842 9:98695381-98695403 CACTGGAGACACCAGCCCCAAGG + Intronic
1060768045 9:126309622-126309644 CATTGCATTCACAGGGCCCAAGG + Intergenic
1060909934 9:127341406-127341428 CAGAGCATGCACCATGGCCAGGG + Intronic
1061100654 9:128489511-128489533 CAGAGTAGACGCCAGGCCCAGGG - Intronic
1061743305 9:132722789-132722811 CAGAGCACACACCCGGCCCTGGG + Intergenic
1203544850 Un_KI270743v1:121192-121214 CAGGGGATGCTCCAGGCCCATGG + Intergenic
1190040195 X:47065104-47065126 CGGTGGATCCAGCAGGCCCATGG - Intergenic
1193242452 X:79187029-79187051 CAGGGCATATAGCAGGGCCAGGG - Intergenic
1194887683 X:99337625-99337647 CTGTGAATCCATCAGGCCCATGG + Intergenic
1199875340 X:151923729-151923751 CTGTGCACCCACCAGGCCCAGGG - Exonic
1199950290 X:152700897-152700919 CTGCGCACCCACCAGGCCCAGGG - Exonic
1199952571 X:152717171-152717193 CTGCGCACCCACCAGGCCCAGGG - Exonic
1199957112 X:152751277-152751299 CTGCGCACCCACCAGGCCCAGGG + Exonic
1199959388 X:152767564-152767586 CTGCGCACCCACCAGGCCCAGGG + Exonic
1200018466 X:153182454-153182476 CTGCACACACACCAGGCCCAGGG - Exonic
1201763685 Y:17561890-17561912 CAGTCCCTGCACCAGGCCCGGGG - Intergenic
1201837868 Y:18344100-18344122 CAGTCCCTGCACCAGGCCCGGGG + Intergenic