ID: 1165313634

View in Genome Browser
Species Human (GRCh38)
Location 19:35042143-35042165
Sequence ATCATAAGTCTTGGGAAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165313634_1165313640 11 Left 1165313634 19:35042143-35042165 CCTCCTTTCCCAAGACTTATGAT 0: 1
1: 0
2: 0
3: 5
4: 169
Right 1165313640 19:35042177-35042199 AGCTGTCTCCTCCCTCAAACCGG 0: 1
1: 0
2: 1
3: 35
4: 229
1165313634_1165313641 12 Left 1165313634 19:35042143-35042165 CCTCCTTTCCCAAGACTTATGAT 0: 1
1: 0
2: 0
3: 5
4: 169
Right 1165313641 19:35042178-35042200 GCTGTCTCCTCCCTCAAACCGGG 0: 1
1: 0
2: 1
3: 31
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165313634 Original CRISPR ATCATAAGTCTTGGGAAAGG AGG (reversed) Exonic