ID: 1165314009

View in Genome Browser
Species Human (GRCh38)
Location 19:35043918-35043940
Sequence CCAGCCCGGAGCTGCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 319}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165314009_1165314024 16 Left 1165314009 19:35043918-35043940 CCTCCCTGGCAGCTCCGGGCTGG 0: 1
1: 1
2: 1
3: 31
4: 319
Right 1165314024 19:35043957-35043979 TGCTGTCAGGGCTAGGGGTGTGG 0: 1
1: 0
2: 5
3: 69
4: 551
1165314009_1165314025 19 Left 1165314009 19:35043918-35043940 CCTCCCTGGCAGCTCCGGGCTGG 0: 1
1: 1
2: 1
3: 31
4: 319
Right 1165314025 19:35043960-35043982 TGTCAGGGCTAGGGGTGTGGAGG 0: 1
1: 2
2: 5
3: 46
4: 492
1165314009_1165314020 9 Left 1165314009 19:35043918-35043940 CCTCCCTGGCAGCTCCGGGCTGG 0: 1
1: 1
2: 1
3: 31
4: 319
Right 1165314020 19:35043950-35043972 GGAGTCCTGCTGTCAGGGCTAGG 0: 1
1: 1
2: 0
3: 20
4: 254
1165314009_1165314021 10 Left 1165314009 19:35043918-35043940 CCTCCCTGGCAGCTCCGGGCTGG 0: 1
1: 1
2: 1
3: 31
4: 319
Right 1165314021 19:35043951-35043973 GAGTCCTGCTGTCAGGGCTAGGG 0: 1
1: 0
2: 2
3: 10
4: 135
1165314009_1165314019 4 Left 1165314009 19:35043918-35043940 CCTCCCTGGCAGCTCCGGGCTGG 0: 1
1: 1
2: 1
3: 31
4: 319
Right 1165314019 19:35043945-35043967 GGAGGGGAGTCCTGCTGTCAGGG 0: 1
1: 0
2: 0
3: 32
4: 275
1165314009_1165314018 3 Left 1165314009 19:35043918-35043940 CCTCCCTGGCAGCTCCGGGCTGG 0: 1
1: 1
2: 1
3: 31
4: 319
Right 1165314018 19:35043944-35043966 TGGAGGGGAGTCCTGCTGTCAGG 0: 1
1: 0
2: 2
3: 14
4: 257
1165314009_1165314022 11 Left 1165314009 19:35043918-35043940 CCTCCCTGGCAGCTCCGGGCTGG 0: 1
1: 1
2: 1
3: 31
4: 319
Right 1165314022 19:35043952-35043974 AGTCCTGCTGTCAGGGCTAGGGG 0: 1
1: 0
2: 3
3: 9
4: 139
1165314009_1165314026 29 Left 1165314009 19:35043918-35043940 CCTCCCTGGCAGCTCCGGGCTGG 0: 1
1: 1
2: 1
3: 31
4: 319
Right 1165314026 19:35043970-35043992 AGGGGTGTGGAGGTCGAACCTGG 0: 1
1: 0
2: 0
3: 16
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165314009 Original CRISPR CCAGCCCGGAGCTGCCAGGG AGG (reversed) Intronic
900537681 1:3186981-3187003 CAGGCCCCGACCTGCCAGGGAGG + Intronic
900579272 1:3400508-3400530 CCACCTAGGAGCTGCCAGGAGGG - Intronic
900971375 1:5993902-5993924 CCAGACCTGAGCTGCCTGGTTGG + Intronic
901053932 1:6440104-6440126 CCGGCCCGCTGCTGCCCGGGGGG - Intronic
901180172 1:7336321-7336343 GCAGCCCAGAGCTGCCTGGTAGG + Intronic
901373266 1:8818054-8818076 CCAGCCCGGCCCAGCCCGGGGGG - Intergenic
901476692 1:9494994-9495016 CTAAACCAGAGCTGCCAGGGTGG - Intergenic
902769395 1:18636925-18636947 TCAGCCCCGCGTTGCCAGGGCGG + Intronic
902775847 1:18674482-18674504 AGAGCCCGGAGCAGGCAGGGAGG + Intronic
902936194 1:19766592-19766614 CCAGCATGGAGCTGGCAGGCAGG - Intronic
903185273 1:21625226-21625248 CCAGGCCAGAGCTCTCAGGGAGG + Intronic
904536350 1:31202054-31202076 CCAGCTTGGAGCTGCTAGGGAGG + Intronic
904609979 1:31720548-31720570 CCAGCCCGGCTCACCCAGGGAGG - Intergenic
904876564 1:33659359-33659381 ACAGCCCAGAGCTGACAGCGGGG + Intronic
905266831 1:36760225-36760247 CCAGGGCAGAGCTGCCAGGCAGG - Intergenic
906197394 1:43937379-43937401 CCATCCCGGAGCTGCTGGGTGGG - Intergenic
908037678 1:60073706-60073728 GCACCTCTGAGCTGCCAGGGTGG - Exonic
908544041 1:65147613-65147635 CCAGCCCGGATCCTGCAGGGCGG - Intronic
911144867 1:94541993-94542015 CGAGCGCGGAGCTGCCCTGGAGG + Intergenic
912836373 1:112999998-113000020 CCAGCCCCCAGCTTCCAGGGAGG - Intergenic
915528243 1:156489161-156489183 GCAGCCCGGAGCAGCCTGGGAGG - Intronic
918148653 1:181780030-181780052 CCATCCAGGAGCTGGGAGGGTGG - Intronic
919855803 1:201705268-201705290 TCAGCCTGGAACTGCCAGGCAGG - Intronic
919924595 1:202185882-202185904 GGAGCCCGGAGCTGGCATGGGGG - Intergenic
919977661 1:202623323-202623345 CCAGCCCTGAGCTGCCTGCTGGG + Intronic
921513695 1:216064263-216064285 TGAGCCCTGAGCTGCCAGGATGG - Intronic
922044416 1:221929297-221929319 GCTGCCTGGAGCTGGCAGGGAGG - Intergenic
922701843 1:227765840-227765862 TCAGCCGGGTGCTGTCAGGGAGG + Intronic
922875553 1:228937215-228937237 CAAGCCCGGGGCTGGAAGGGCGG + Intergenic
1062979648 10:1711151-1711173 CCAGCCCTGAGCTTCCAGATGGG - Intronic
1063273754 10:4541017-4541039 CCAGCTGGGAGCTGGCACGGTGG - Intergenic
1065670744 10:28113981-28114003 CCTGCCAGGAGTGGCCAGGGAGG + Intronic
1066428141 10:35327848-35327870 CCAGCCAGGAGCCACCATGGAGG - Intronic
1066464109 10:35639006-35639028 CCAGCCAAGTGCAGCCAGGGAGG + Exonic
1067067200 10:43110807-43110829 GCAGCTGGGAGCAGCCAGGGAGG + Intronic
1067755390 10:49000868-49000890 CCAGCCAGGAGCACCCAGCGTGG + Intergenic
1068690190 10:59906418-59906440 CCAGCCCGCCGCGGCCATGGCGG - Exonic
1069728668 10:70597544-70597566 CCAGCCCTGAGCAGCCTGGTGGG + Exonic
1069950420 10:72014749-72014771 CCACCCCTCAGCTGCCAGGCCGG + Intergenic
1071527493 10:86366741-86366763 CCAGCCCAGAGCCGCCACGCCGG - Intergenic
1072903663 10:99431070-99431092 CCAGCCCGGGCCCGCCAGGCCGG - Intergenic
1073572619 10:104593258-104593280 GCTGCCCTGAGGTGCCAGGGAGG - Intergenic
1074419180 10:113294009-113294031 CCAGCCAGGCCCTGCCAGAGAGG + Intergenic
1075268343 10:121025643-121025665 GCATCCGGGAGCTGCCGGGGAGG + Intergenic
1075279768 10:121129561-121129583 CCACCCAGGAGCTGGCTGGGTGG - Intergenic
1075718582 10:124571731-124571753 CCAGCGTGGTGCTGGCAGGGTGG - Intronic
1075741329 10:124698194-124698216 CCAGCCCGTGCCTGCCAGGTGGG + Intronic
1075796531 10:125123929-125123951 CCAGCACAGAGCTGCCCCGGGGG - Intronic
1076627520 10:131831168-131831190 ACAGCCCGAGGCTGGCAGGGTGG - Intergenic
1076681830 10:132176317-132176339 CCAGGCAGGAGCTGCCAGCAGGG - Intronic
1077185670 11:1234400-1234422 CCAGGGCGGAGCTTCCAGGTGGG - Intronic
1077235960 11:1482121-1482143 CCAGGCTGTAGCTGCCCGGGTGG - Intronic
1077352073 11:2097647-2097669 CCAGATCAGAGCAGCCAGGGCGG - Intergenic
1077370888 11:2181127-2181149 CCTGCCAGGGGCGGCCAGGGAGG + Intergenic
1077804936 11:5580975-5580997 CCAGCCCAGGGATGCCAGTGAGG - Exonic
1078102528 11:8338261-8338283 CCAGCCCCGATCCTCCAGGGAGG + Intergenic
1078360579 11:10664638-10664660 CCAGCCCTGGGATGCCAGGAAGG - Intronic
1081814392 11:45930388-45930410 CCAGCTGGAGGCTGCCAGGGCGG + Intronic
1081831769 11:46120957-46120979 CCTGCCTCCAGCTGCCAGGGGGG - Exonic
1082807763 11:57461140-57461162 CCGGCCCGGAGCGGGGAGGGAGG + Intronic
1083365632 11:62140097-62140119 CCACCCCGGAGCTGCCAGGAAGG + Intronic
1083435268 11:62638742-62638764 CCAGCCCAGGCCTGTCAGGGAGG + Intronic
1083682315 11:64357301-64357323 CCAGCCTGGAGCTGCTCGTGGGG - Exonic
1083714408 11:64567507-64567529 CCCACCAGGAGCTGCCTGGGAGG - Intronic
1083852446 11:65376258-65376280 CCAGCCCAGATCTGCGCGGGTGG + Exonic
1084386280 11:68844323-68844345 CAGGCCCGGAGCTCCCCGGGAGG - Intronic
1084550912 11:69841093-69841115 AAAGCCCAGGGCTGCCAGGGAGG - Intergenic
1084968306 11:72755825-72755847 TCTGCCCAGAGCTTCCAGGGAGG + Intronic
1085399594 11:76227734-76227756 CCTGCATGGAGCTGCCATGGTGG - Intergenic
1085521955 11:77144326-77144348 CCTGCCCAGAGCCCCCAGGGTGG + Intronic
1088305473 11:108402509-108402531 CCACTTCAGAGCTGCCAGGGAGG + Intronic
1089396290 11:118138046-118138068 CCAGCTCAGAGCGGTCAGGGTGG - Intronic
1090413163 11:126522841-126522863 GCAGCCTGGGGCTGCCAGAGGGG - Intronic
1092147966 12:6227876-6227898 CCAGCCAGCAGCTGACAGGTGGG + Intronic
1092155412 12:6278854-6278876 GCAGGACGGGGCTGCCAGGGCGG - Intergenic
1092169414 12:6363809-6363831 CCATCCCGGAGAAGCCTGGGCGG + Intronic
1092384721 12:8027152-8027174 CCGGGCCGGAGCTGACACGGGGG + Intergenic
1095954758 12:47799641-47799663 CAGGCCCAGAGCTGCCATGGAGG - Intronic
1096478179 12:51921279-51921301 CCCCACCAGAGCTGCCAGGGTGG + Intronic
1096699232 12:53371405-53371427 CCAGCCCGGAGCTGGAAGACTGG - Intergenic
1098943026 12:76559396-76559418 CCCGTGCGGAGCTCCCAGGGAGG + Exonic
1099981162 12:89604857-89604879 CAAGTCTGGAGCTGACAGGGGGG - Intronic
1100433155 12:94548248-94548270 CCAGGCCTGCGCTGCCATGGGGG - Intergenic
1102592317 12:113966131-113966153 CCAGCCGGGAGCTGTGAGGTAGG - Intronic
1102952624 12:117040674-117040696 CCACCCCGGGGCTGGCAGGGCGG - Intronic
1103141205 12:118549907-118549929 AAAGCCAGGAGCTGCCAGGGAGG + Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1103924080 12:124414107-124414129 CCAGCCCTGATCCGCCAGGTAGG - Intronic
1103959488 12:124600045-124600067 CCAGGCCCCAGCTGCCAGGAGGG - Intergenic
1104024060 12:125013572-125013594 CCAGTCCCTAGCTGCGAGGGAGG + Intronic
1104859050 12:131915341-131915363 CCATCCCTGAGCGGCCAGGCTGG + Exonic
1104859833 12:131918202-131918224 CCAGCCCAGATCTGCCTGGGAGG - Intronic
1104934049 12:132355140-132355162 CCCGGCCGGAGCTCGCAGGGAGG + Intergenic
1104969873 12:132526491-132526513 CCAGCTCCCAGCTGCCAGAGGGG - Intronic
1105003251 12:132704635-132704657 CCAGAACAGAGCTGCCAGGTTGG - Exonic
1105826835 13:24130222-24130244 CCAGCCCCTGGCTTCCAGGGTGG - Intronic
1106690282 13:32107756-32107778 CCTGCCCTGAGGAGCCAGGGAGG + Intronic
1107975450 13:45683935-45683957 CCAGGCAGGAGTTGCCTGGGTGG - Intergenic
1112563870 13:100535905-100535927 CCAGACTAGAGCTGGCAGGGAGG - Intronic
1113769471 13:112898952-112898974 CCTGCCCGGTGCTCCCTGGGAGG - Intronic
1113821469 13:113216787-113216809 CCAGCAAGGAGTTGGCAGGGCGG + Intronic
1117873291 14:60222936-60222958 CCAGGGCAGAGCTGCCAGCGTGG + Intergenic
1119071206 14:71586459-71586481 CCAGCACTGAGCTGACAGGGCGG - Intronic
1119548733 14:75492841-75492863 CCAGCCAGGAGGTGCCAGGCTGG - Intergenic
1119662576 14:76462474-76462496 CCAGCCCTGCGCTGGCAGGTGGG + Intronic
1119732915 14:76962489-76962511 CCAGCCCTGGGGAGCCAGGGAGG + Intergenic
1119765917 14:77187563-77187585 GCTGCACGGAGCAGCCAGGGAGG + Intronic
1121511447 14:94515962-94515984 CCAGCCCGCAGCATCCAAGGTGG + Exonic
1121732300 14:96195110-96195132 CCAGCCAGGCCCTGCCAGGCAGG - Intergenic
1122126512 14:99581402-99581424 CCAGGACAGAGCTGCCAGGTAGG + Intronic
1122171065 14:99876203-99876225 CCAGGCAGGAGCTGCCTGGATGG + Intronic
1122221398 14:100240554-100240576 CCAGCCCGGCGCTGGGTGGGCGG - Intronic
1122745325 14:103894302-103894324 CCAGCCCGGGCCGGCCAAGGAGG - Intergenic
1122782488 14:104149563-104149585 TCAGACAGCAGCTGCCAGGGAGG - Intronic
1122833847 14:104421461-104421483 CCAGCTCAGAGATGCCCGGGAGG + Intergenic
1122875072 14:104660182-104660204 CCTGGCCGCAGCTGTCAGGGAGG - Intergenic
1123063405 14:105604696-105604718 CCAACCCAGAGCTGGGAGGGAGG - Intergenic
1123717572 15:23042382-23042404 CCTGGCCAGAGGTGCCAGGGGGG + Intergenic
1123718664 15:23046158-23046180 CCTGGCCAGAGGTGCCAGGGGGG + Intergenic
1123719829 15:23050188-23050210 CCTGGCCGGAGGTGCCGGGGGGG + Intergenic
1124036310 15:26056827-26056849 CCAGCCCGCAGCTGCAATGTGGG + Intergenic
1124493311 15:30171687-30171709 CCAGCCCTGAGCTGCCTGCTGGG + Intergenic
1124750223 15:32366638-32366660 CCAGCCCTGAGCTGCCTGCTGGG - Intergenic
1125506049 15:40268240-40268262 CCGGCCCGGAGCAGCTCGGGGGG - Intronic
1125754887 15:42056952-42056974 CAAGGCCGGCCCTGCCAGGGTGG - Intergenic
1129397361 15:75259124-75259146 CCAGCCCAGAGAGCCCAGGGAGG - Intronic
1129901904 15:79157789-79157811 CTCACCCGGAGCTGCCAGGGTGG - Intergenic
1132326472 15:100973992-100974014 CCAGCCCGGGGCTGCATGGGTGG - Intronic
1132552355 16:558839-558861 CCGGCCCGGAGCTGCCTGCACGG + Intergenic
1132567392 16:629809-629831 CTGGGCTGGAGCTGCCAGGGAGG - Intronic
1132622495 16:874433-874455 GCAGCCCCGGACTGCCAGGGCGG - Intronic
1132656690 16:1044472-1044494 CCCGCCCGGGGCCGCCTGGGGGG + Intergenic
1132807403 16:1781542-1781564 CCAGCCCTGAGCTTCCAGGCTGG + Intronic
1133133194 16:3690907-3690929 CCAGCCTGGAGCTTGCAGGCAGG - Exonic
1134831036 16:17323053-17323075 GCAGCCCTGACCTGCCATGGAGG - Intronic
1136571811 16:31102493-31102515 CTAGTCCTGAGCTGCCAGGTGGG - Intergenic
1137751354 16:50863337-50863359 CCAGCCGGGAGCGGCCGGTGAGG + Intergenic
1137988636 16:53131020-53131042 CCTGCCCCGCGCTGACAGGGGGG + Intronic
1138458245 16:57133343-57133365 CCTCCCCTGGGCTGCCAGGGAGG + Intronic
1139851150 16:69952140-69952162 CCAGCTGGGCTCTGCCAGGGGGG + Intronic
1139880128 16:70175052-70175074 CCAGCTGGGCTCTGCCAGGGGGG + Intronic
1140372381 16:74420465-74420487 CCAGCTGGGCTCTGCCAGGGGGG - Intronic
1141815630 16:86407745-86407767 CCACCTCTCAGCTGCCAGGGAGG + Intergenic
1141938192 16:87255806-87255828 CCAGAGCGGAGCTGTCAGTGGGG - Intronic
1142306545 16:89289149-89289171 CCAGCCAGGAGCTGCCTGCCCGG - Intronic
1142903875 17:3029671-3029693 CCAGCCAGCAGCTTCCAGGAAGG + Intronic
1143153841 17:4823266-4823288 CCAGCCCATTGCTGCCAAGGTGG + Exonic
1144174602 17:12693019-12693041 CCAGCCCCGAGCTACAAGCGTGG + Intronic
1144583459 17:16473562-16473584 TCAGCCAGATGCTGCCAGGGAGG + Intronic
1144586871 17:16492321-16492343 CCAGCCCGGAGCCGCGGGGCGGG - Intergenic
1144728175 17:17512084-17512106 CGTGCCGGGAGCTGCCAGAGAGG + Intronic
1145397051 17:22504509-22504531 CCAGCCCAGAGGTGCCATGCTGG + Intergenic
1145979326 17:29002544-29002566 CCAGCCCCGGGCTTCCAAGGAGG - Intronic
1148017072 17:44529346-44529368 CCAGCACGGAGAGGCCAAGGTGG - Intergenic
1150248685 17:63694203-63694225 CCAGCCCAGAGATGCCCTGGTGG - Exonic
1151786399 17:76277132-76277154 CCTGCCTGGAGCCACCAGGGAGG - Intronic
1151945736 17:77318988-77319010 CCAGCCCTGTGCGGCCAGGCAGG + Intronic
1152114752 17:78378725-78378747 CCAGCCCTGGGCGGCCAGGCAGG - Exonic
1152115716 17:78385862-78385884 CCTGCCTGGGGCTGCCTGGGTGG + Intronic
1152729558 17:81962743-81962765 TCAGCCCGGGGCTGGCAAGGAGG - Intergenic
1153294184 18:3530116-3530138 CCAGCCAGGAGCTGGGTGGGTGG + Intronic
1154139472 18:11810579-11810601 TCAGCCCGGAGCCTGCAGGGAGG + Intronic
1154202272 18:12308033-12308055 CGGGCCCGGAGCTGGCGGGGAGG - Intronic
1155902686 18:31410908-31410930 CAAGCCCGCAGCAGCCACGGCGG + Intronic
1156462806 18:37331138-37331160 CCAGCGCTGCGCTGCCTGGGCGG + Intronic
1157166939 18:45366367-45366389 CCAGCCAGGTGCTACCAGGTGGG + Intronic
1157610645 18:48952763-48952785 GGAGCCCGGAGCTGAGAGGGCGG - Intergenic
1160160098 18:76464569-76464591 CCAGGCTGGGGGTGCCAGGGAGG - Intronic
1160160133 18:76464695-76464717 CCAGGCTGGGGGTGCCAGGGAGG - Intronic
1160413345 18:78689275-78689297 CCACAAAGGAGCTGCCAGGGTGG + Intergenic
1160537734 18:79603983-79604005 CCATCCTGGAGGTGCCAGGCGGG - Intergenic
1160923049 19:1529508-1529530 CCAGCCCGGGGCTGCAGGTGGGG + Intronic
1161979839 19:7624621-7624643 CCTGCCCTGCACTGCCAGGGTGG + Intronic
1162070514 19:8149580-8149602 CCAGCCCAGAGCTGCCACTCGGG + Exonic
1162381476 19:10334260-10334282 CCAGCCGGGAGGTGCCGGTGGGG - Exonic
1162421566 19:10568691-10568713 CCAGCCCGGCGCTGTCAGCGCGG + Exonic
1163268572 19:16235711-16235733 CCAGCCCTGACCTGCCAAAGTGG + Intronic
1163338031 19:16686448-16686470 CCAACCTGGAGGTGGCAGGGTGG - Intronic
1163704020 19:18801975-18801997 CCTCCCTGAAGCTGCCAGGGTGG - Intergenic
1165213858 19:34255075-34255097 CCATCCCGGGGCTGCCGGGCGGG + Intronic
1165314009 19:35043918-35043940 CCAGCCCGGAGCTGCCAGGGAGG - Intronic
1166809700 19:45507845-45507867 CCAGCCCGGAGCTAGCTGGGGGG - Intronic
1167049173 19:47068255-47068277 CCAGCCCGGAGGTGGGCGGGAGG - Intronic
1168241511 19:55091335-55091357 CCAGTCCGGAGGTCCCAGGGGGG + Exonic
925062539 2:904686-904708 CCACACCAGTGCTGCCAGGGAGG - Intergenic
925188314 2:1864403-1864425 GAAGGCCGGAGCTGGCAGGGAGG - Intronic
926006558 2:9377570-9377592 CCAGCCTTCAGCTGCCAGGCAGG - Intronic
926130957 2:10302888-10302910 CCTTCCCGGAGCTGGCAGGCGGG + Intronic
926148416 2:10411197-10411219 CCAGCCAGGAGCACCCTGGGTGG + Intronic
927937662 2:27084591-27084613 CAAGCCTGGGGCTGCCAGCGGGG - Intronic
929555955 2:42925775-42925797 CCAGACAGGACCTGGCAGGGAGG - Intergenic
931430652 2:62206232-62206254 CCAGCCCAGAGCTGCATGGAGGG - Intronic
931618822 2:64189558-64189580 CCAGCTGGGAGCTCCCAGGGAGG - Intergenic
934518882 2:95007009-95007031 CCAGCCTGCTGCAGCCAGGGCGG + Intergenic
934522937 2:95031282-95031304 CTTGCCCAGAGCTGCCAGGTGGG - Intronic
934650502 2:96088894-96088916 ACAGCCTGGAGCTGGCAGGACGG + Intergenic
935279044 2:101502090-101502112 ACACCCAGGAGCAGCCAGGGAGG + Intergenic
936158780 2:110068851-110068873 CCAGCCCACAGCTCACAGGGTGG - Intergenic
936185880 2:110302481-110302503 CCAGCCCACAGCTCACAGGGTGG + Intergenic
937047374 2:118858920-118858942 CCAGCCCTGAGCTCCTGGGGTGG + Intergenic
937281017 2:120717186-120717208 CCATCCCAGAGCTGCCAGGAAGG - Intergenic
937972839 2:127564042-127564064 CCAGCCCAGAGCTCCCAAGGTGG - Intronic
937989729 2:127655417-127655439 CCAGGCGGCAGCTGCCAGCGAGG + Intronic
939275225 2:139990977-139990999 CCAGCCGGCCGCTCCCAGGGCGG + Intergenic
940856062 2:158729592-158729614 CCAGCGTGGAGCAGCCTGGGAGG + Intergenic
941476195 2:165953939-165953961 CCAGCCCGGACCCTCCCGGGCGG - Intergenic
945246442 2:207721854-207721876 CCAGCCAGGAGCTGCCACCGAGG - Intronic
947206767 2:227667933-227667955 CCAGCACGGGGCTGCTGGGGAGG + Intergenic
947760489 2:232600309-232600331 CCAGACCGCAGCTGCCAGGATGG + Intergenic
948465656 2:238150519-238150541 TCAGCCCGGACCTCCCCGGGAGG + Intronic
1168989198 20:2079779-2079801 CCATCCTGTAGCTGCAAGGGAGG + Intergenic
1169353128 20:4886120-4886142 CCACCCTGGAGCTGCCTGGGTGG - Intronic
1171309446 20:24134795-24134817 CCAGCCTGGAGCAGCCACTGGGG + Intergenic
1171974792 20:31587704-31587726 CCAGCCCAGAGCTGCCGCTGGGG + Intergenic
1172390663 20:34562785-34562807 CCAGCCTGGAGCTGCCAGCTGGG - Intronic
1172775626 20:37405033-37405055 CCAGCCAGGCCCTGCCAGTGGGG + Exonic
1173221574 20:41136866-41136888 CCAGCCCCGCGCTGCCGGGGGGG + Intergenic
1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG + Intergenic
1174979144 20:55372921-55372943 TCATCCCTGAGCTGCAAGGGTGG - Intergenic
1175382944 20:58576328-58576350 CCAGCCCAGAACTGCCTGGCAGG - Intergenic
1175394658 20:58650299-58650321 CCGGCCCGGAGCCGCCCGGGAGG - Intergenic
1175399539 20:58692755-58692777 GCAGCCCGGAGCGGCGGGGGAGG + Exonic
1175517616 20:59578927-59578949 CCAGTGCTGAGCTCCCAGGGTGG + Intronic
1175554051 20:59835262-59835284 CCAGCCAGGAATTGTCAGGGGGG + Intronic
1175671203 20:60904069-60904091 CCACCCTGGAGATGCCAGGCTGG + Intergenic
1175692383 20:61074969-61074991 CCAGCCCTGAGTTGTCAGAGTGG + Intergenic
1175877026 20:62235221-62235243 CCAGCCAGCAGCTGCCAGCCAGG + Intronic
1176372204 21:6068911-6068933 CCAGCCCAGGCCTGCCACGGCGG - Intergenic
1176372588 21:6071270-6071292 CCAGGCCGGAGTGGGCAGGGCGG + Intergenic
1179189239 21:39108841-39108863 CCTGCCCTCATCTGCCAGGGAGG - Intergenic
1179627681 21:42657830-42657852 ACAGCCCAGAGGCGCCAGGGAGG - Intronic
1179750888 21:43466975-43466997 CCAGGCCGGAGTGGGCAGGGCGG - Intergenic
1179751315 21:43469628-43469650 CCAGCCCAGGCCTGCCACGGCGG + Intergenic
1180134168 21:45850374-45850396 CCAGCCCCGAGAAGCCAAGGAGG + Intronic
1180159304 21:45992012-45992034 CGAGCCTGGAGCTGACGGGGAGG + Exonic
1180161108 21:45999094-45999116 CCAGCGCGCAGATGCCCGGGTGG + Intronic
1180169598 21:46050966-46050988 CCAGCCTGGTGCTGGCAGGGTGG - Intergenic
1181493044 22:23272760-23272782 CCAGCCCGTCCTTGCCAGGGTGG + Intronic
1181782392 22:25202544-25202566 CCAGCCTGGAGCTGGCACTGAGG - Intronic
1182052157 22:27321633-27321655 CCATCCCTCAGCTCCCAGGGAGG + Intergenic
1182522098 22:30890545-30890567 ACAGCCAGGAGGGGCCAGGGAGG + Intronic
1182779783 22:32858419-32858441 CCAGCCTTGAACTGCCAGGTGGG - Intronic
1183350955 22:37334645-37334667 CCAGCCCGGAGCGCCCAGGCGGG - Intergenic
1184206140 22:43004803-43004825 CAAGCCCAGAGCGCCCAGGGAGG - Intronic
1184400457 22:44270864-44270886 CGAGCCCAGAGCAGCCAGGCTGG + Intronic
1184438305 22:44493815-44493837 ACAGGCTGGAACTGCCAGGGTGG + Exonic
950177180 3:10882999-10883021 CCTGCCCAGAGCTGGCAAGGTGG - Intronic
950433772 3:12966914-12966936 CAGGGCCGGAGCTGCCAGGAAGG - Intronic
950672545 3:14535895-14535917 CCAGCCCTCAGTGGCCAGGGAGG - Intronic
953387534 3:42515019-42515041 CCAGCCCAGACATGCCAGGCTGG - Intronic
953454206 3:43029206-43029228 TCAGCTCAGAGCTGCAAGGGAGG + Intronic
954196030 3:48997807-48997829 CGAGCCAGGAGCTGCAATGGAGG + Intronic
954429937 3:50465149-50465171 CCAGGCTGCAGCTGCCCGGGAGG + Intronic
956699665 3:71947910-71947932 CCAGCCCGCACCTGCCTGGCTGG - Intergenic
960305243 3:116052511-116052533 CCAGTCCGGAGTTTCCAGGAAGG - Intronic
962269187 3:133965747-133965769 CCAGTGCGGTGCTGTCAGGGTGG - Intronic
967381520 3:188864301-188864323 CCAGCACTGTGCTGCCAGAGTGG + Intronic
968085840 3:195873550-195873572 ACAGCCCAGAGCTGCTAGGGTGG + Intronic
968756880 4:2420962-2420984 CCATGCCCCAGCTGCCAGGGAGG + Intronic
968910711 4:3475829-3475851 CCACCACGGAGGTGCTAGGGAGG - Intronic
969103919 4:4790736-4790758 CACACCCCGAGCTGCCAGGGAGG - Intergenic
969277672 4:6147833-6147855 CCAGCCCTGTGAGGCCAGGGTGG - Intronic
969613282 4:8238586-8238608 CAGGCCTGGGGCTGCCAGGGAGG + Intronic
976513488 4:85937113-85937135 CCAGCCAAGTGCTGCCATGGTGG - Intronic
980075431 4:128288325-128288347 CCAGCCCGGACCTGCCCCCGCGG - Exonic
983919771 4:173333714-173333736 GGAGCCCGCAGCTGCCAGGGCGG + Intronic
985490406 5:175516-175538 AGAGGCCAGAGCTGCCAGGGTGG - Intronic
985551878 5:537903-537925 CCAGCCCACTGCTGCCGGGGAGG + Intergenic
985782306 5:1877791-1877813 CAAGCCCGGCGCTGCCACGCCGG - Exonic
988609726 5:32712844-32712866 CCAGCCCGGCGCTGGCAAAGTGG - Intronic
989417375 5:41195452-41195474 CAAGCTGGGAGGTGCCAGGGTGG - Intronic
995246602 5:109942330-109942352 CCAGCCTAGAGGTCCCAGGGAGG + Intergenic
996594380 5:125184699-125184721 CCATGCAGGGGCTGCCAGGGTGG - Intergenic
997198531 5:131995452-131995474 CCAGCCCAGTGATGGCAGGGTGG + Intronic
997975535 5:138439566-138439588 CCAGCCCAGACCTGCTAGGTGGG - Intronic
998063169 5:139135192-139135214 CCAGCCCCCAGCTGGCAAGGTGG + Intronic
998364325 5:141618957-141618979 CGGGCGCGGAGCTGCCAGGCGGG - Exonic
998406250 5:141876319-141876341 CGAGGCCGGAGATGCCGGGGAGG - Intronic
1000072638 5:157755059-157755081 CCAGGTCAGAGCTGTCAGGGAGG + Exonic
1002346814 5:178553870-178553892 TCAGTCGGGAGCTGCCAGAGAGG - Intronic
1002884093 6:1278561-1278583 CCAGCCCTGACCTGCCACAGTGG + Intergenic
1003102437 6:3187093-3187115 CCTGCACGGAGCTGCCAAGTTGG + Intergenic
1005515500 6:26550602-26550624 CCAGAGCGGAGCAGCCAGAGGGG - Intergenic
1005971274 6:30763842-30763864 CCAGCCCCGAGCTGCCTGCCTGG - Intergenic
1005999784 6:30955860-30955882 CCAGCCCCCAGCCCCCAGGGAGG + Intergenic
1006083243 6:31579662-31579684 CCAGCCCTGGGGTGCCAGGCAGG + Intergenic
1006728476 6:36217296-36217318 GCAGCCCGGAACTTCCTGGGAGG - Intronic
1006942609 6:37762985-37763007 GCAGCCCGGAGCTGTCAGGATGG - Intergenic
1007431565 6:41780084-41780106 CAAGCCCGGAGGGGACAGGGCGG + Intronic
1007484103 6:42168717-42168739 CCAACCCTGAGCTGGCAGGGAGG + Intronic
1011284047 6:85705407-85705429 CAGGCACGGAGCAGCCAGGGAGG + Intergenic
1011434532 6:87322670-87322692 CCGGCCTGGAGGGGCCAGGGCGG + Intronic
1017497526 6:154995187-154995209 CCAGCCGGGAGCTGGCGCGGGGG + Intronic
1019367697 7:643763-643785 AAAGCCCAGAGCTGCCAGGCAGG + Intronic
1019409069 7:898785-898807 GCAGCCCGGCGCGGCCAGGTAGG - Exonic
1019451881 7:1103101-1103123 CCCGGACGGGGCTGCCAGGGAGG - Intronic
1019609411 7:1929390-1929412 CCAGCCTGGACGTGGCAGGGGGG + Intronic
1019713025 7:2525963-2525985 CCTGCTCAGAGCAGCCAGGGGGG + Intronic
1019713756 7:2529245-2529267 CCGCCCCGGGGCTGCCAGGAGGG - Intergenic
1019733097 7:2638169-2638191 CCAGCCAGGAGCCGCCAGACTGG - Intronic
1019999405 7:4746799-4746821 CCAGCCCAGATCAGCCAGGCAGG - Intronic
1020100415 7:5391193-5391215 CCAGGCAGGAGCTGCCAGGAAGG + Intronic
1020115381 7:5473286-5473308 GCAGAACGGAGCGGCCAGGGTGG - Intronic
1021819477 7:24481832-24481854 ACTGCCTGGAGCTGCCAGGCAGG - Intergenic
1022348115 7:29538362-29538384 CCACACCGCTGCTGCCAGGGAGG - Intergenic
1023335165 7:39161498-39161520 CCAGCCTGGATCTGCCTGGCAGG - Intronic
1024996176 7:55274571-55274593 CCTGCAGGGAGCTGCCACGGAGG - Intergenic
1025227560 7:57178172-57178194 GCAGCCAGGAGCAGGCAGGGTGG - Intergenic
1027396709 7:77763770-77763792 GCAGCCTGGACCTGCCAGGCTGG + Intronic
1029250665 7:99233831-99233853 CCAGCCAGGAGCTGCCCTGAGGG - Intergenic
1032201633 7:129826210-129826232 CCAGGCCGGAGCTGGCAGTCAGG - Intergenic
1032326719 7:130935871-130935893 CCTTCACGGAGCTGCCAGGCTGG - Intergenic
1032590045 7:133183455-133183477 CCAGCCCAGAGCTCTCATGGAGG - Intergenic
1033362437 7:140647128-140647150 CCAGCCCTTCGCAGCCAGGGAGG - Intronic
1033514536 7:142093240-142093262 CCAGCTCTGAGCTGCAACGGCGG - Intronic
1034492703 7:151402498-151402520 CCAGCCAGCCGCTGCCAGTGGGG - Intronic
1035356311 7:158277855-158277877 CCAGACAGGAGAAGCCAGGGAGG - Intronic
1035663075 8:1361971-1361993 GCAGCCAGGAGGTGCCAGAGAGG - Intergenic
1039586687 8:38712903-38712925 CCAGAGCAGAGCTGCCAGGAGGG - Intergenic
1039760991 8:40575090-40575112 TCAGCCTTGAGCAGCCAGGGTGG - Intronic
1040330905 8:46385322-46385344 CCAGCCCGGGGCAGCCTTGGGGG - Intergenic
1040940084 8:52823779-52823801 CCCGACCTGAGCTGCCAGGATGG + Intergenic
1041244992 8:55880636-55880658 CCTGCCCGGGGCCACCAGGGAGG - Intronic
1047259164 8:123240968-123240990 CCAGCCGGCAGCAGCCAGGCCGG + Intronic
1049443938 8:142621575-142621597 CCAGCCTGGAGCTGGTGGGGAGG + Intergenic
1049674304 8:143882951-143882973 ACAGCCCTGAGCAGCAAGGGTGG - Intergenic
1049756232 8:144312360-144312382 CCAGCCCCGAGCTCCGAGGTTGG - Intronic
1049780318 8:144425839-144425861 CCTGCCCGGAGGTGCCACTGCGG + Intronic
1055902517 9:81257558-81257580 GCAGCCTGAAGCTGTCAGGGAGG + Intergenic
1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG + Intronic
1057304164 9:93902852-93902874 CCAGCAAGAAGCTGGCAGGGTGG - Intergenic
1057858975 9:98624810-98624832 CGAGCCCGGGGCAGACAGGGAGG + Intronic
1060199760 9:121645591-121645613 CCAGCACAGAGCAGTCAGGGTGG - Intronic
1060375975 9:123115371-123115393 CCAGCCCAGGGCTGGCAAGGAGG + Intronic
1061318219 9:129810931-129810953 CCAGCCCGGTGCTGCCACAAAGG - Exonic
1061377632 9:130235620-130235642 CCAGCCCAGAGCTGCCGGAAGGG + Exonic
1061621224 9:131812493-131812515 GCTGCCCGGAGCTGGCAGGGCGG + Intergenic
1061726899 9:132587087-132587109 TCTCCCCGGAGCTGCCCGGGGGG + Intronic
1062150689 9:135017324-135017346 CCTGCCAGGAGCTGCCTGCGTGG + Intergenic
1062253375 9:135609178-135609200 CAAGCCCTGAGCCCCCAGGGGGG + Intergenic
1062274846 9:135725890-135725912 CCAGACCTGGGCTCCCAGGGCGG - Intronic
1062403049 9:136380771-136380793 CCAGCCTGGGGCAGCCTGGGTGG + Exonic
1062423247 9:136494110-136494132 AGAGCCCCGAGCTGCCAGGAGGG + Intergenic
1062474649 9:136720993-136721015 CCAGCCAGAAGCTGCCATGCAGG + Intronic
1062521166 9:136958608-136958630 CCAGCCAGGAGCTGATACGGAGG - Intergenic
1062592670 9:137281144-137281166 CCAACCCGGGCCTGCCCGGGAGG + Exonic
1189291087 X:39886656-39886678 CCATCCCTGTTCTGCCAGGGTGG + Intergenic
1190598254 X:52067068-52067090 CCAGACGGGACCTGGCAGGGAGG - Exonic
1190610570 X:52187005-52187027 CCAGACGGGACCTGGCAGGGAGG + Exonic
1198727373 X:139691871-139691893 CCAGCCCGAGGCCGCCGGGGAGG + Intronic
1199996604 X:153030225-153030247 ACAGGCAGGAGCTGCCTGGGCGG - Intergenic
1200099851 X:153685012-153685034 CCAGCCCAGAGCTCCTATGGTGG - Intronic
1201411410 Y:13702887-13702909 CCACCGCGGAGTTGCCAGGACGG - Intergenic