ID: 1165318045

View in Genome Browser
Species Human (GRCh38)
Location 19:35068645-35068667
Sequence CTGGGGACTCTGAGAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165318043_1165318045 -6 Left 1165318043 19:35068628-35068650 CCTGTGTTTTAGGAAGTCTGGGG No data
Right 1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG No data
1165318039_1165318045 15 Left 1165318039 19:35068607-35068629 CCAGCTGAGAAATGTACTGTACC No data
Right 1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG No data
1165318038_1165318045 27 Left 1165318038 19:35068595-35068617 CCTTTGTAATTGCCAGCTGAGAA No data
Right 1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165318045 Original CRISPR CTGGGGACTCTGAGAGAACA TGG Intergenic
No off target data available for this crispr