ID: 1165325169

View in Genome Browser
Species Human (GRCh38)
Location 19:35110142-35110164
Sequence GGTGAACTCATCCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165325160_1165325169 16 Left 1165325160 19:35110103-35110125 CCAGGAAGGGGCAGAGCTGGGAC No data
Right 1165325169 19:35110142-35110164 GGTGAACTCATCCAGGAGGAAGG No data
1165325156_1165325169 23 Left 1165325156 19:35110096-35110118 CCCACAGCCAGGAAGGGGCAGAG No data
Right 1165325169 19:35110142-35110164 GGTGAACTCATCCAGGAGGAAGG No data
1165325166_1165325169 -7 Left 1165325166 19:35110126-35110148 CCAAGGGGCTGTGAACGGTGAAC No data
Right 1165325169 19:35110142-35110164 GGTGAACTCATCCAGGAGGAAGG No data
1165325165_1165325169 -6 Left 1165325165 19:35110125-35110147 CCCAAGGGGCTGTGAACGGTGAA No data
Right 1165325169 19:35110142-35110164 GGTGAACTCATCCAGGAGGAAGG No data
1165325157_1165325169 22 Left 1165325157 19:35110097-35110119 CCACAGCCAGGAAGGGGCAGAGC No data
Right 1165325169 19:35110142-35110164 GGTGAACTCATCCAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165325169 Original CRISPR GGTGAACTCATCCAGGAGGA AGG Intergenic
No off target data available for this crispr