ID: 1165325956

View in Genome Browser
Species Human (GRCh38)
Location 19:35114958-35114980
Sequence TACCCCGAGGTCCCCCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165325952_1165325956 -6 Left 1165325952 19:35114941-35114963 CCTGTTGCTTAGAGCCCTACCCC No data
Right 1165325956 19:35114958-35114980 TACCCCGAGGTCCCCCCGCCCGG No data
1165325947_1165325956 20 Left 1165325947 19:35114915-35114937 CCTTCCTGTTTCTATCTCCTCCT No data
Right 1165325956 19:35114958-35114980 TACCCCGAGGTCCCCCCGCCCGG No data
1165325950_1165325956 3 Left 1165325950 19:35114932-35114954 CCTCCTGGACCTGTTGCTTAGAG No data
Right 1165325956 19:35114958-35114980 TACCCCGAGGTCCCCCCGCCCGG No data
1165325951_1165325956 0 Left 1165325951 19:35114935-35114957 CCTGGACCTGTTGCTTAGAGCCC No data
Right 1165325956 19:35114958-35114980 TACCCCGAGGTCCCCCCGCCCGG No data
1165325943_1165325956 30 Left 1165325943 19:35114905-35114927 CCGGGCCTCCCCTTCCTGTTTCT No data
Right 1165325956 19:35114958-35114980 TACCCCGAGGTCCCCCCGCCCGG No data
1165325945_1165325956 22 Left 1165325945 19:35114913-35114935 CCCCTTCCTGTTTCTATCTCCTC No data
Right 1165325956 19:35114958-35114980 TACCCCGAGGTCCCCCCGCCCGG No data
1165325946_1165325956 21 Left 1165325946 19:35114914-35114936 CCCTTCCTGTTTCTATCTCCTCC No data
Right 1165325956 19:35114958-35114980 TACCCCGAGGTCCCCCCGCCCGG No data
1165325949_1165325956 16 Left 1165325949 19:35114919-35114941 CCTGTTTCTATCTCCTCCTGGAC No data
Right 1165325956 19:35114958-35114980 TACCCCGAGGTCCCCCCGCCCGG No data
1165325944_1165325956 25 Left 1165325944 19:35114910-35114932 CCTCCCCTTCCTGTTTCTATCTC No data
Right 1165325956 19:35114958-35114980 TACCCCGAGGTCCCCCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165325956 Original CRISPR TACCCCGAGGTCCCCCCGCC CGG Intergenic
No off target data available for this crispr