ID: 1165325978

View in Genome Browser
Species Human (GRCh38)
Location 19:35115004-35115026
Sequence GCTCCCTCCTACCACTCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165325978_1165325982 0 Left 1165325978 19:35115004-35115026 CCTTAAGAGTGGTAGGAGGGAGC No data
Right 1165325982 19:35115027-35115049 CTTACCCTTGTCTAGGACCTGGG No data
1165325978_1165325987 20 Left 1165325978 19:35115004-35115026 CCTTAAGAGTGGTAGGAGGGAGC No data
Right 1165325987 19:35115047-35115069 GGGCTTGACAACTTGCCCCAGGG No data
1165325978_1165325986 19 Left 1165325978 19:35115004-35115026 CCTTAAGAGTGGTAGGAGGGAGC No data
Right 1165325986 19:35115046-35115068 TGGGCTTGACAACTTGCCCCAGG No data
1165325978_1165325979 -7 Left 1165325978 19:35115004-35115026 CCTTAAGAGTGGTAGGAGGGAGC No data
Right 1165325979 19:35115020-35115042 AGGGAGCCTTACCCTTGTCTAGG No data
1165325978_1165325981 -1 Left 1165325978 19:35115004-35115026 CCTTAAGAGTGGTAGGAGGGAGC No data
Right 1165325981 19:35115026-35115048 CCTTACCCTTGTCTAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165325978 Original CRISPR GCTCCCTCCTACCACTCTTA AGG (reversed) Intergenic
No off target data available for this crispr