ID: 1165329077

View in Genome Browser
Species Human (GRCh38)
Location 19:35131472-35131494
Sequence CCCACCGTGAATGCCAGCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 62}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165329077_1165329083 5 Left 1165329077 19:35131472-35131494 CCCACGCTGGCATTCACGGTGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 1165329083 19:35131500-35131522 ACTGCAGGAGCCAGAGGACGCGG 0: 1
1: 1
2: 1
3: 50
4: 338
1165329077_1165329081 -1 Left 1165329077 19:35131472-35131494 CCCACGCTGGCATTCACGGTGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 1165329081 19:35131494-35131516 GCATCCACTGCAGGAGCCAGAGG 0: 1
1: 0
2: 2
3: 29
4: 245
1165329077_1165329087 23 Left 1165329077 19:35131472-35131494 CCCACGCTGGCATTCACGGTGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 1165329087 19:35131518-35131540 CGCGGCAGTCACACTGGAACGGG 0: 1
1: 0
2: 0
3: 2
4: 56
1165329077_1165329080 -10 Left 1165329077 19:35131472-35131494 CCCACGCTGGCATTCACGGTGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 1165329080 19:35131485-35131507 TCACGGTGGGCATCCACTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 79
1165329077_1165329086 22 Left 1165329077 19:35131472-35131494 CCCACGCTGGCATTCACGGTGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 1165329086 19:35131517-35131539 ACGCGGCAGTCACACTGGAACGG 0: 1
1: 0
2: 1
3: 2
4: 54
1165329077_1165329085 17 Left 1165329077 19:35131472-35131494 CCCACGCTGGCATTCACGGTGGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 1165329085 19:35131512-35131534 AGAGGACGCGGCAGTCACACTGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165329077 Original CRISPR CCCACCGTGAATGCCAGCGT GGG (reversed) Exonic
900168406 1:1254293-1254315 CCTACTGTGAAGGCCAGCGCAGG + Intronic
900569104 1:3349647-3349669 CCGCCCGTGAAAGCCAGCCTTGG + Intronic
900823130 1:4905361-4905383 CCCACCGTGGCTGCCCGCCTGGG + Intergenic
905516013 1:38562721-38562743 CCCACCTTGAATGCCATCCATGG + Intergenic
907437975 1:54461849-54461871 CCTGCAGTGAATGCCAGCATGGG + Intergenic
907976208 1:59433770-59433792 CCCACCGTCTAAGCCAGTGTAGG + Intronic
1067278131 10:44852153-44852175 CCTGCCGTGACCGCCAGCGTGGG + Intergenic
1076434090 10:130427648-130427670 CCCACCCTAAATGCCAGCCCTGG - Intergenic
1081611286 11:44565107-44565129 CCGCCCTGGAATGCCAGCGTGGG + Intronic
1083098694 11:60280829-60280851 CCAACCCTGAATACCAGCTTGGG - Intronic
1094250932 12:28360405-28360427 CCCACCGTGAATGACTGCAAAGG - Intronic
1102463064 12:113112177-113112199 CCCATCGTGGACGCCATCGTGGG - Exonic
1107198515 13:37683760-37683782 CCCACCTTGAATTCCAGTGTTGG + Intronic
1112723488 13:102274270-102274292 CCCACAGTGAATCCCACCTTGGG + Intronic
1113590212 13:111493656-111493678 CCCATTGTGTATCCCAGCGTGGG + Intergenic
1122005359 14:98698956-98698978 CACACCGTGAATGCTAGCCGTGG - Intergenic
1122642796 14:103170460-103170482 CGCAGCCTGAATACCAGCGTTGG + Intergenic
1131179467 15:90230106-90230128 CCCACGGGGACAGCCAGCGTGGG + Exonic
1131542798 15:93288899-93288921 TCCACAGTGAATGGCAGCATGGG - Intergenic
1132612339 16:823597-823619 CTCACCGTGAAACCCAGCATCGG - Intergenic
1137737048 16:50732414-50732436 CCCACCCTGGGTGCCAGGGTTGG - Exonic
1141594443 16:85088736-85088758 CCCACCGTGAGTGGCAGCGCCGG - Exonic
1141619934 16:85231958-85231980 ACCGCCATGAATGCCAGTGTTGG + Intergenic
1142692768 17:1616857-1616879 CCCACTGGGAATGCCAGGGCTGG + Intronic
1145000857 17:19303629-19303651 ACCACCGATAGTGCCAGCGTTGG + Intronic
1150009349 17:61490094-61490116 CACTCCGTGAATGACAGCTTAGG - Intergenic
1156446740 18:37242383-37242405 CAGACCCTGAATGCCAGGGTGGG - Intergenic
1159338457 18:67101697-67101719 CACCCCCTGAATGCCAGCGCAGG + Intergenic
1159884564 18:73891764-73891786 CCCCCCGAGAAAGCCAGCCTTGG - Intergenic
1160839681 19:1140552-1140574 CCCACGGTGGATGCCAGCAGCGG + Intronic
1161011072 19:1959661-1959683 CCCACCTTTAGTGCCACCGTGGG + Intronic
1161249871 19:3274826-3274848 TCCACCCTGGCTGCCAGCGTGGG + Intronic
1162044281 19:7988362-7988384 CCCACCGTGAGTGTCAGCTTTGG + Intronic
1165329077 19:35131472-35131494 CCCACCGTGAATGCCAGCGTGGG - Exonic
1166321759 19:42023121-42023143 CCCACTGTGAAATCCAGGGTCGG + Intronic
926795539 2:16616154-16616176 CCCACCGTGAAGGACAGAGCAGG - Intronic
934935096 2:98459577-98459599 CACACTGTGAATGCCATTGTGGG - Intronic
935590867 2:104844674-104844696 CCCACCGTGGAGGCCCGCGGCGG - Intergenic
937119533 2:119432009-119432031 CCCACCGCGAGCGCCGGCGTCGG + Intronic
1178022936 21:28430707-28430729 GCCACACTGAATGCCAGGGTGGG - Intergenic
951140218 3:19149048-19149070 CCCACAGTGAATACGGGCGTCGG - Intronic
956313915 3:67913540-67913562 CCCACCTTAATTGCCAGCGGTGG - Intergenic
968499992 4:945397-945419 CCCACCGTTCATTCCAGCCTCGG + Intronic
969539583 4:7778666-7778688 CCACCCGTGAGTGCCAGCTTGGG - Intronic
985000159 4:185474672-185474694 CCCACCTCGAATACCAGGGTTGG - Intergenic
998423036 5:142004960-142004982 CCCACCGTCAAGGCCATGGTGGG + Exonic
1001095379 5:168771820-168771842 CCCGGGGAGAATGCCAGCGTGGG - Intronic
1002665247 5:180818522-180818544 GCCACAGTGAATTCCAACGTAGG - Intergenic
1004559257 6:16731783-16731805 ACCACAGAGAATGCCAGTGTAGG - Intronic
1017566881 6:155696324-155696346 CCCGCAGTGAATGCCTGCCTCGG - Intergenic
1018172443 6:161153143-161153165 CCCACCCTGAGTGCCAGCCAGGG + Intronic
1025956872 7:66189854-66189876 TCCACCTTGACTGCCAGCCTAGG + Intergenic
1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG + Intronic
1026904461 7:74054966-74054988 CCCACTGGGAATGCCATCCTGGG - Intronic
1029655862 7:101924048-101924070 CTCACCGTGCCTGCCAGGGTCGG - Intronic
1033116021 7:138626255-138626277 GCCAGGGTGAATGGCAGCGTTGG - Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1037662559 8:20940294-20940316 CCCAGCCTGAATGACAGAGTAGG + Intergenic
1038516822 8:28194441-28194463 CCCACCGTCAGTGCCAGCCGTGG + Intergenic
1047321016 8:123783131-123783153 CCCACCCTGCATTCCAGCCTAGG + Intronic
1049273297 8:141707488-141707510 CCCAGCGTGAATGGGAGCTTTGG + Intergenic
1049282185 8:141755318-141755340 CCTACTGTGAATGCCTGCTTTGG + Intergenic
1049684170 8:143932662-143932684 CCTACCGTGACTGCCTGGGTCGG - Exonic
1055936846 9:81611874-81611896 CTCGCCGTTCATGCCAGCGTGGG + Exonic
1060820502 9:126658956-126658978 CCCACCCTGTATCCCAGCCTTGG - Intronic
1060920292 9:127415751-127415773 CTCACAGTGAATGCCAGGTTTGG - Intergenic
1192264366 X:69529036-69529058 CCCAGCAGGAATGCCAGCGCTGG + Exonic