ID: 1165329727

View in Genome Browser
Species Human (GRCh38)
Location 19:35134767-35134789
Sequence GCGTGCCAGCAGGCGGATGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165329727_1165329736 23 Left 1165329727 19:35134767-35134789 CCTCCATCCGCCTGCTGGCACGC 0: 1
1: 0
2: 1
3: 5
4: 102
Right 1165329736 19:35134813-35134835 TTCTCCGTCTTTCTTTCAGTCGG 0: 1
1: 0
2: 1
3: 29
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165329727 Original CRISPR GCGTGCCAGCAGGCGGATGG AGG (reversed) Exonic
903184017 1:21619352-21619374 GTGTGCGAGCTGGCGGGTGGGGG + Intronic
904028892 1:27521677-27521699 GCGAGCCAGCCGGTGGAGGGAGG + Intergenic
908147446 1:61261845-61261867 GTGTGCCAGAAAGCAGATGGTGG + Intronic
909608909 1:77532788-77532810 GGGTGCCAGCAGGGTGATGTTGG + Intronic
915348041 1:155207979-155208001 GGGGGCCAGCAGGCGGGTGAGGG + Intronic
919021223 1:192108355-192108377 CATTGCTAGCAGGCGGATGGGGG + Intergenic
1067174609 10:43935473-43935495 AGGTGCCAGCAGGCTGCTGGTGG + Intergenic
1073133663 10:101207208-101207230 GCCTGCATGCAGGCAGATGGAGG - Intergenic
1074850284 10:117433988-117434010 GGGTGCCAGCATGGGGCTGGGGG - Intergenic
1075840130 10:125494354-125494376 GTGGGCCAGCAGACAGATGGGGG - Intergenic
1077195861 11:1279615-1279637 GCGTGCGTGCAGGTGGCTGGTGG - Intronic
1082142204 11:48622383-48622405 GAGTGCCAGCAAAGGGATGGTGG + Intergenic
1089281885 11:117380539-117380561 GAGAGCCAGCAGGAGGATGGAGG + Intronic
1094208911 12:27869849-27869871 CAGTGCCAGCAGGAGGATGGCGG + Intergenic
1102603842 12:114053577-114053599 GCGGGGCAGCAGGCGGTGGGAGG + Intergenic
1114628797 14:24146692-24146714 GCCTGCCAGCGGGAGGAGGGGGG - Exonic
1114675880 14:24440175-24440197 GCGTGCCATCATGCTGCTGGAGG - Exonic
1118124177 14:62881468-62881490 GCCTGCCAGAAGGCGGAGGGTGG + Intronic
1121930313 14:97966296-97966318 GGGTTCCAGTAGGCGGGTGGTGG - Intronic
1122105698 14:99452827-99452849 CCGAGCCAGCAGGCAGATCGCGG + Intronic
1122207002 14:100152678-100152700 GCCTGAAAGCAGGCGGAGGGTGG - Intronic
1122901314 14:104783471-104783493 GGATGCCAGCTGGCTGATGGTGG - Intronic
1125610518 15:40966285-40966307 GCGGGTCAGCAGGCGGAGGAAGG + Intergenic
1129164196 15:73767001-73767023 GCGTGATAGAAGGGGGATGGTGG + Intergenic
1129275474 15:74442626-74442648 GGATGTGAGCAGGCGGATGGTGG - Intergenic
1129325539 15:74798551-74798573 GTGCGCCAGCAGGTGGCTGGAGG + Intronic
1134099300 16:11440417-11440439 GTGCCCCAGCAGGCAGATGGAGG - Intronic
1136270438 16:29145235-29145257 GCGTGCTGGCAGGCGGGCGGGGG + Intergenic
1138425381 16:56928704-56928726 GAGTGCCAGCAGGCCGGGGGCGG + Intergenic
1139421871 16:66854008-66854030 CCGTGGCAGCAGGTGGCTGGAGG - Exonic
1141625681 16:85259853-85259875 CCGTGCCAGCATCCAGATGGGGG + Intergenic
1142074024 16:88107044-88107066 GCGTGCTGGCAGGCGGGCGGGGG + Intronic
1142175897 16:88645174-88645196 GCGTGGCAGCAGGGAGACGGGGG + Intronic
1142211699 16:88811593-88811615 TCGCGCCAGGAGGCCGATGGCGG + Exonic
1143470920 17:7174535-7174557 GGGTCCCAGCAGGAGGATGTAGG - Intronic
1144761141 17:17708145-17708167 GGGTGGCAGCAGGAGGAAGGAGG - Intronic
1145884237 17:28371599-28371621 GCGTGGCTGCAGGAGGCTGGAGG + Intronic
1146034003 17:29390550-29390572 GCGGGCCGGCCGGCGGACGGCGG - Intronic
1147440978 17:40447103-40447125 GAGTGTCAGCAGGTGGCTGGGGG + Intronic
1151630500 17:75307890-75307912 CTGTGCCCGCAGGAGGATGGAGG + Intergenic
1152924593 17:83081158-83081180 GCGGGGCCGCGGGCGGATGGAGG + Intronic
1155317259 18:24584450-24584472 GTGTGCCAGGAGGCGGCAGGGGG + Intergenic
1160623523 18:80187606-80187628 GGGAGCCAGGAGGTGGATGGGGG - Intronic
1160969680 19:1762073-1762095 GACTGCCAGAGGGCGGATGGGGG - Intronic
1161101725 19:2424912-2424934 GGGTGCCAGCCGGCCGCTGGGGG + Intronic
1163354306 19:16799941-16799963 GCGGGCCAGCAGGCTCACGGGGG - Exonic
1163683508 19:18697081-18697103 TGGTGCCAGCAGCTGGATGGGGG + Intronic
1165329727 19:35134767-35134789 GCGTGCCAGCAGGCGGATGGAGG - Exonic
1166186879 19:41145614-41145636 GCGTGCCTGTAGGCTGAGGGAGG - Intergenic
1166228570 19:41412272-41412294 GTGGGCAAGCAGGTGGATGGTGG - Intronic
1166864967 19:45830307-45830329 GAGAGGCAGCAGGGGGATGGGGG - Intronic
1168312146 19:55465664-55465686 GGGGGCCAGCAGGCAGGTGGGGG + Intergenic
926321313 2:11750048-11750070 GCGTGCCAGCAGGCAAATGGGGG - Intronic
932020246 2:68077432-68077454 GTGTCCCAGCAGGAGGATGAGGG + Intronic
932414599 2:71566027-71566049 GCATGTGAGCAGGTGGATGGGGG - Intronic
932567052 2:72917042-72917064 GCGGCCCAGGAGGCCGATGGTGG + Intronic
936026452 2:109034519-109034541 GCAAGCCAGCAGGCAGAGGGAGG + Intergenic
936110489 2:109660597-109660619 CCATGCCAGGAGGCAGATGGGGG + Intergenic
936920961 2:117687805-117687827 GCCTGCCAGCAGTCGCAAGGTGG + Intergenic
944264063 2:197705419-197705441 GCGTCCTAGCAGGCGGAGGACGG - Exonic
946685375 2:222264373-222264395 GATTGCCAGGAGACGGATGGGGG + Intronic
1173223266 20:41146404-41146426 GTGTGCCAGCTGGCAGGTGGAGG - Intronic
1174059340 20:47821635-47821657 GTGTGCCATCTGGGGGATGGAGG + Intergenic
1175375683 20:58522065-58522087 GCGACCCAGCTGGTGGATGGCGG - Intergenic
1179801912 21:43815203-43815225 GCGTGGCAGCAGGGGAAAGGGGG + Intergenic
1181266311 22:21632968-21632990 GCCTGCCTGCAGACGCATGGGGG + Intronic
1184667246 22:45995500-45995522 GCGTGCACCCAGGGGGATGGAGG - Intergenic
1184867299 22:47208919-47208941 GAGTGCCAGCAGGCAGAGGTAGG - Intergenic
954228653 3:49199556-49199578 GCGTGCCAGCAGCCAGAGGTGGG + Intronic
956702650 3:71972285-71972307 GAGAGCGAGCAGGCAGATGGTGG - Intergenic
961629970 3:128289413-128289435 GCCTGGCAGGAGGCAGATGGAGG + Intronic
961736529 3:129005218-129005240 GCGTGGCAGCAGGCAGGAGGTGG + Intronic
962278530 3:134033222-134033244 GCATGGCAGCAGTGGGATGGTGG + Intronic
965629433 3:170716554-170716576 GCGTGCCTCCAGATGGATGGTGG + Intronic
968815286 4:2818543-2818565 CCGTCCCGGCGGGCGGATGGGGG + Intronic
977927300 4:102715645-102715667 GCCTGCCAGAAGGTGGAGGGTGG - Intronic
986766756 5:10935254-10935276 GCGTGCCAGCACCAGGTTGGAGG + Intergenic
990954666 5:61331003-61331025 GCGTGCCAGGCGGCGGACGGCGG - Intergenic
998957222 5:147451188-147451210 GCATGGCAGGAGGCGGATGTTGG - Intronic
999306256 5:150521442-150521464 GAGTGGCAGCAGGCGACTGGGGG - Exonic
1001277182 5:170359478-170359500 GCGAGCCAGGACTCGGATGGTGG - Intronic
1001398781 5:171434501-171434523 GCGTGCCAGCGTGGGAATGGGGG + Intronic
1002897687 6:1389160-1389182 GCGGGCCAGGAGGAGGAAGGGGG + Intergenic
1005473929 6:26188957-26188979 GCGAGCCAGGCGGCGGATAGCGG + Exonic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1006400413 6:33814147-33814169 CCGGGCCAGCAGGTGGGTGGTGG - Intergenic
1006640830 6:35488858-35488880 GCGTGCCACCATGCTGAGGGGGG - Intronic
1006922237 6:37634599-37634621 GTGTGCCAGCAGGTGGGTGGGGG - Exonic
1007752516 6:44079131-44079153 CCGTGCCAGCAGGCAGAGGAGGG - Intergenic
1007944713 6:45815772-45815794 GCTAGCCAGCAGAGGGATGGCGG + Intergenic
1016109562 6:140205959-140205981 GCCTGCCAGCATGCGGGTGCTGG - Intergenic
1019918340 7:4147727-4147749 GGGTGGCAGCAGGGGGATAGGGG - Intronic
1020180033 7:5915104-5915126 CCGTGACAGCAGGAGGAGGGAGG + Intronic
1020302901 7:6809778-6809800 CCGTGACAGCAGGAGGAGGGAGG - Intronic
1034450097 7:151132661-151132683 CCGTGCCATCAGGGGAATGGTGG - Intronic
1035685038 8:1517606-1517628 GTGTGCCTGCATTCGGATGGAGG - Intronic
1046348064 8:112963054-112963076 GGATTCCAGCAGGCGGATGAAGG + Intronic
1049206340 8:141365389-141365411 AAGTGCCAGCAGGCAGATTGAGG - Intronic
1049417272 8:142500809-142500831 GCCTGGAAGCAGGGGGATGGTGG + Intronic
1049528456 8:143141698-143141720 GCGGGGCAGCAGGCAGAGGGCGG - Intergenic
1049756766 8:144314269-144314291 GCCTGTCAGCAGGGAGATGGTGG - Exonic
1054856623 9:69907115-69907137 GCATGGCAGGAGGGGGATGGGGG + Intergenic
1059453765 9:114387177-114387199 CCCTGCCAGCAGGTGGGTGGGGG - Intronic
1061271805 9:129547973-129547995 GCCTGGCAGCAGGGGGGTGGGGG + Intergenic
1062525686 9:136977241-136977263 CCCTGCCAGCAGGAGGAGGGTGG + Intergenic
1189740576 X:44113553-44113575 GTGTGCAAGCAGGCAGCTGGGGG + Intergenic
1197079289 X:122393307-122393329 GGGTGCCAGCAGGCAGAGAGGGG + Intergenic
1197893724 X:131289341-131289363 GCGGGCCGGCAGGCGGGCGGGGG - Exonic
1199881199 X:151975057-151975079 GCGTGCCAGCGGGCAGGAGGGGG - Intergenic