ID: 1165330518

View in Genome Browser
Species Human (GRCh38)
Location 19:35139108-35139130
Sequence GACACACACGTGTGTAGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165330515_1165330518 -2 Left 1165330515 19:35139087-35139109 CCTGGCAGGGTGTGGAGTTGGGA 0: 1
1: 1
2: 2
3: 43
4: 358
Right 1165330518 19:35139108-35139130 GACACACACGTGTGTAGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 141
1165330504_1165330518 23 Left 1165330504 19:35139062-35139084 CCCTGCCCTGCTGGTGCGTGTGC 0: 1
1: 0
2: 0
3: 22
4: 251
Right 1165330518 19:35139108-35139130 GACACACACGTGTGTAGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 141
1165330505_1165330518 22 Left 1165330505 19:35139063-35139085 CCTGCCCTGCTGGTGCGTGTGCA 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1165330518 19:35139108-35139130 GACACACACGTGTGTAGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 141
1165330507_1165330518 17 Left 1165330507 19:35139068-35139090 CCTGCTGGTGCGTGTGCACCCTG 0: 1
1: 0
2: 2
3: 17
4: 162
Right 1165330518 19:35139108-35139130 GACACACACGTGTGTAGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 141
1165330513_1165330518 -1 Left 1165330513 19:35139086-35139108 CCCTGGCAGGGTGTGGAGTTGGG 0: 1
1: 0
2: 5
3: 45
4: 385
Right 1165330518 19:35139108-35139130 GACACACACGTGTGTAGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 141
1165330503_1165330518 26 Left 1165330503 19:35139059-35139081 CCTCCCTGCCCTGCTGGTGCGTG 0: 1
1: 0
2: 0
3: 34
4: 376
Right 1165330518 19:35139108-35139130 GACACACACGTGTGTAGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 141
1165330506_1165330518 18 Left 1165330506 19:35139067-35139089 CCCTGCTGGTGCGTGTGCACCCT 0: 1
1: 0
2: 0
3: 18
4: 124
Right 1165330518 19:35139108-35139130 GACACACACGTGTGTAGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165330518 Original CRISPR GACACACACGTGTGTAGGGC TGG Exonic
900161447 1:1225994-1226016 CACACACACGTGAACAGGGCTGG + Intronic
900299185 1:1968583-1968605 GCCGCACACCTGTGGAGGGCAGG - Intronic
900328093 1:2120643-2120665 GACACACAGGTGTGAAGTGTGGG - Intronic
902720593 1:18301714-18301736 CACGCACATGTGTGTAGGGGTGG - Intronic
904575961 1:31505275-31505297 TATACACACGTGTGTTGGGCTGG + Intergenic
906608417 1:47186624-47186646 GACACACACAGGTGAAGGGCAGG - Intronic
907497406 1:54854023-54854045 GACATCCACGTGAGTGGGGCAGG - Exonic
908108765 1:60874193-60874215 CACACAGGGGTGTGTAGGGCGGG + Intronic
920913915 1:210242887-210242909 GAAACACACCTGTCTAGGGGCGG + Exonic
921162451 1:212482892-212482914 GACCCAAACATGTGTATGGCTGG - Intergenic
1069893656 10:71667257-71667279 GACACCCAGGTGTCTAGGGAGGG + Intronic
1072750597 10:97975682-97975704 GCCTCACACGGGGGTAGGGCTGG + Intronic
1075030386 10:119020772-119020794 GACACACCCGTGTGTGGGTGGGG + Intergenic
1076921254 10:133455837-133455859 GACAGTCACGTGGGTGGGGCAGG + Intergenic
1077819272 11:5720013-5720035 GACACAGATGTGTGTGGTGCAGG - Intronic
1078930246 11:15906878-15906900 TACACGCTTGTGTGTAGGGCCGG - Intergenic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1079568845 11:21917042-21917064 GACTCACAGTTCTGTAGGGCTGG - Intergenic
1079818700 11:25095578-25095600 GACTCACACTTCTGCAGGGCTGG - Intergenic
1081373938 11:42337527-42337549 CACACACACGTGTTTAGAACTGG + Intergenic
1084350921 11:68598534-68598556 GAGACACAAGTGGGTAGGGTTGG + Intronic
1085464857 11:76716532-76716554 AACAGACAGGTGGGTAGGGCAGG - Intergenic
1090199889 11:124846409-124846431 GAGACACATGTGTGCCGGGCTGG - Intergenic
1091158080 11:133392536-133392558 GAAGCACACGTGTGGAGGACAGG - Intronic
1094065510 12:26357369-26357391 GACACACTAATGTGTAGGGAGGG + Intronic
1095765021 12:45885653-45885675 GACTCACACTTCTGCAGGGCTGG + Intronic
1097377809 12:58859802-58859824 GACTCACAGTTCTGTAGGGCTGG + Intergenic
1098796119 12:74889992-74890014 CACACACACATGTTTAGGACAGG - Intergenic
1100567225 12:95808311-95808333 GATCCCCACGTGTGTAGGGAGGG - Intronic
1103728517 12:123011088-123011110 GAGGCACATGTGTGTTGGGCAGG + Intronic
1106550088 13:30763533-30763555 GACAGACACGTGTGTAATGCAGG - Intronic
1107038703 13:35926832-35926854 GTCACACAGGTGAGAAGGGCAGG + Intronic
1109132192 13:58601558-58601580 GACTCACAGTTCTGTAGGGCTGG + Intergenic
1109564313 13:64091347-64091369 GACTCACAGTTGTGCAGGGCTGG + Intergenic
1113893444 13:113748662-113748684 GACTCACACGGCTGGAGGGCAGG - Intergenic
1114802451 14:25792786-25792808 CACCCACAGGTGTGGAGGGCAGG - Intergenic
1117209498 14:53481123-53481145 GGCACACTCGTGTGAAGGGTGGG + Intergenic
1119326478 14:73762485-73762507 GGCACACATGTGTGCAGGGGAGG + Intronic
1119934878 14:78582940-78582962 CACACACACCTGTGTACGCCTGG - Intronic
1121566029 14:94909894-94909916 GACCCACCTGTGTGTATGGCAGG - Intergenic
1122026528 14:98881617-98881639 GACACACAGTTCTGCAGGGCTGG + Intergenic
1122986192 14:105212733-105212755 GACACACAGGGCTGTCGGGCGGG + Intronic
1124637405 15:31373873-31373895 CACACACGCGTGTGTTGGGGGGG + Exonic
1124845729 15:33288158-33288180 GACTCACAGTTCTGTAGGGCTGG - Intergenic
1125308428 15:38350073-38350095 GACACACATGTGTGTAGCTTGGG - Intronic
1127769643 15:62220865-62220887 GACACAAATGTGTCTATGGCTGG + Intergenic
1129936363 15:79453460-79453482 CACAAACAACTGTGTAGGGCAGG - Intronic
1137532781 16:49292302-49292324 GCCACACAAGTGTGTATAGCTGG + Intergenic
1138347842 16:56330955-56330977 GACACACAGGTGGCCAGGGCCGG + Intronic
1143307422 17:5958523-5958545 GACAAACACGTGTGGGGGGTGGG + Intronic
1143421471 17:6796488-6796510 GACACACACCAGGGCAGGGCTGG - Intronic
1144092486 17:11870529-11870551 GACACACATTTGGGTATGGCAGG - Intronic
1144867859 17:18348316-18348338 GACAAGCACCTGAGTAGGGCTGG + Exonic
1153753590 18:8258423-8258445 AACACACCCTTGTCTAGGGCTGG - Intronic
1155821288 18:30381028-30381050 GACCCACATTTGTGTATGGCTGG + Intergenic
1156745915 18:40390918-40390940 GACACACACATGGGTAAGGCTGG + Intergenic
1156888504 18:42163640-42163662 GACTCACACTTGTGTGGGTCAGG - Intergenic
1159138002 18:64360260-64360282 GACTCACAGTTGTGCAGGGCTGG + Intergenic
1160486633 18:79299311-79299333 GACACACACAAGAGAAGGGCTGG - Intronic
1162017606 19:7853820-7853842 GACACCAGGGTGTGTAGGGCAGG + Intronic
1163602086 19:18255331-18255353 GCCACACACCTGTGCAGAGCCGG - Exonic
1163983039 19:20919776-20919798 GATACTCAGGTGTCTAGGGCAGG - Intergenic
1165330518 19:35139108-35139130 GACACACACGTGTGTAGGGCTGG + Exonic
1165419517 19:35715999-35716021 GGCACACAGGTGAGTCGGGCGGG + Exonic
1165762792 19:38331767-38331789 GACACACACATGCATATGGCTGG - Intergenic
925742403 2:7017730-7017752 TACACACACGTGTGTAGATTGGG + Intronic
929029075 2:37634095-37634117 GACTCACACTTCTGCAGGGCTGG - Intergenic
931140747 2:59454992-59455014 GATACACCCATGTGTAGGGGTGG + Intergenic
935515646 2:104035046-104035068 AACACACACGTGTGTGTAGCTGG - Intergenic
935979551 2:108613498-108613520 GACACAGAGATGTGTAGGGAGGG - Intronic
937171466 2:119874907-119874929 GACACACACGTGAGAAGAACAGG - Intronic
937908805 2:127065429-127065451 GACACCCAGGGGAGTAGGGCAGG - Intronic
938248776 2:129798031-129798053 GATCCACACGTGTGTGGGGGAGG + Intergenic
941557689 2:167003197-167003219 CACAAACACTTGTGTAGGACTGG + Intronic
942656286 2:178217479-178217501 GACACACACGAGTTTAGGAGTGG + Intronic
944882645 2:204028977-204028999 AACACACATGTGTGTTGGGTGGG + Intergenic
948486525 2:238284926-238284948 GGCACACATCTGTGGAGGGCAGG - Intronic
948617111 2:239206409-239206431 CACACACACATGGGTATGGCTGG + Intronic
1169265422 20:4164387-4164409 GTCACACACCTCTGTGGGGCAGG + Intronic
1173978255 20:47203578-47203600 GACTCACACTTCTGCAGGGCTGG - Intergenic
1174180510 20:48671612-48671634 AACACATAATTGTGTAGGGCGGG - Intronic
1176846966 21:13884189-13884211 GAGAAACAAGTGTGTAGGGTGGG - Intergenic
1182875669 22:33689200-33689222 TACACACATGTGTGTCAGGCTGG + Intronic
1184508153 22:44916667-44916689 GACACACAGGAGTGCAGGGGAGG + Intronic
1184905657 22:47484168-47484190 GACACACATGTGCGTAGACCTGG - Intronic
1184989086 22:48155144-48155166 CACACACAGGTGGGGAGGGCAGG + Intergenic
950192862 3:10990228-10990250 GACAGTCATGGGTGTAGGGCAGG + Intergenic
953960922 3:47265113-47265135 GACACACACATCTGTGAGGCTGG + Intronic
954030694 3:47818064-47818086 GACACACATGGGTGGAAGGCGGG - Exonic
954258305 3:49421317-49421339 GACACAGACATTTGTAGGGAGGG - Intronic
954456627 3:50603147-50603169 GACACACAGCTGAGTGGGGCTGG - Intergenic
957979191 3:87486746-87486768 GACTCACAGTTCTGTAGGGCTGG + Intergenic
961824246 3:129590486-129590508 GACACACACATGTGTCGGATGGG + Intronic
962946337 3:140174206-140174228 GTCCCACAAGTGTCTAGGGCAGG + Intronic
965794321 3:172423125-172423147 GACTCACAGGTTTGTAGGGCTGG - Intergenic
970961804 4:21880017-21880039 GACTCACACTTTTGCAGGGCTGG - Intronic
973606222 4:52589988-52590010 CACACACACAGGTGTTGGGCAGG + Intergenic
978379857 4:108115878-108115900 CACACACACGGCTGTAAGGCAGG + Intronic
980408354 4:132382347-132382369 GACTCACATTTGTGCAGGGCTGG + Intergenic
982435250 4:155377262-155377284 GACAATCACGTGTGTAGGAAAGG - Intergenic
982875363 4:160641263-160641285 CACACACACGTGTGTAGGTGTGG + Intergenic
986317227 5:6597959-6597981 GCCACACAGGTGTGTGGGGATGG - Intergenic
991770813 5:70039335-70039357 GACTCACAGTTGTGTATGGCTGG + Intronic
991850107 5:70914752-70914774 GACTCACAGTTGTGTATGGCTGG + Intronic
996564450 5:124864567-124864589 GAAACACATGTGTGTTGGCCTGG + Intergenic
996944619 5:129051493-129051515 GACACATACCAGTGAAGGGCAGG + Intergenic
998759157 5:145412795-145412817 GACACACAGTTCTGTATGGCTGG + Intergenic
1002298991 5:178247153-178247175 GAGACAGATGTGTGTGGGGCGGG + Intronic
1007340455 6:41188118-41188140 AACACACACCTGGGAAGGGCTGG - Intergenic
1008893545 6:56524588-56524610 GACACACAGATGTTTAGAGCTGG - Intronic
1015905534 6:138113041-138113063 TACACACCCGTGTGGAGGGGAGG - Intergenic
1015956255 6:138601395-138601417 GCCACACAAGTGTCTAGGGATGG - Intronic
1017719612 6:157235701-157235723 GGCACAGACGTGTGCGGGGCCGG + Intergenic
1017763862 6:157591542-157591564 GACTCACAGTTCTGTAGGGCTGG - Intronic
1018824349 6:167397918-167397940 ACCACACACCTGTGCAGGGCAGG - Intergenic
1019658714 7:2211658-2211680 AACACAGACTTCTGTAGGGCCGG - Intronic
1030907769 7:115207483-115207505 GACTCACACTTCTGCAGGGCTGG + Intergenic
1033275116 7:139966097-139966119 AACACCCTCGTGCGTAGGGCTGG - Intronic
1035928043 8:3750731-3750753 GACAGCCCCGTGTGGAGGGCTGG + Intronic
1037265556 8:17055789-17055811 GACACACACTTGTGTTGTGTTGG + Intronic
1041844809 8:62316151-62316173 GACCCACAGTTCTGTAGGGCTGG - Intronic
1042423809 8:68623160-68623182 GACAAACAACTGTGTAGGCCAGG - Intronic
1043611583 8:82069665-82069687 GGCCCCCACGTGTGTAGCGCTGG - Intergenic
1044788475 8:95822093-95822115 GACACACACCTTAGTAAGGCTGG - Intergenic
1047793186 8:128226477-128226499 TACACAAAAGTGTATAGGGCAGG - Intergenic
1048049466 8:130803763-130803785 CACACTCACATGTGTAGTGCAGG - Intronic
1051237059 9:15012515-15012537 GCCAAACACGTGTGTTGGGCAGG - Intergenic
1052878864 9:33587928-33587950 GAAAAACAAGTGTGTAGGGTCGG + Intergenic
1053497109 9:38556292-38556314 GAAAAACAAGTGTGTAGGGTCGG - Intronic
1055315155 9:75027816-75027838 GACACGCGGGTGTGCAGGGCCGG + Intronic
1056617688 9:88182510-88182532 GAAACACACGTGTGGGGGTCAGG + Intergenic
1057036086 9:91812566-91812588 CACACACACGTGTGTGTGGGGGG - Intronic
1057128706 9:92638697-92638719 GACACACTCGTTTGTGGTGCTGG - Intronic
1057465400 9:95309768-95309790 GACACACATGTTTGTGGGGTGGG + Intronic
1060235311 9:121858608-121858630 GGCCCACATGGGTGTAGGGCAGG + Intronic
1060811187 9:126612447-126612469 GACACACACGCAGGTAGGGTAGG + Intergenic
1062339027 9:136085669-136085691 GACACACAGGTATGCAGGGGAGG + Intronic
1185825273 X:3243497-3243519 GACACACACGTTTTTATGGAGGG + Intergenic
1186108481 X:6230284-6230306 AACACACACGTATGTATGGATGG - Intergenic
1192410846 X:70930942-70930964 GACCCACACGTGTGTCGGAGGGG - Intronic
1192437057 X:71149364-71149386 GAGACAGAGGTGTGTATGGCAGG - Intronic
1192834214 X:74782015-74782037 GACACAGACATCTGAAGGGCTGG + Intronic
1194577325 X:95628385-95628407 GACACACACACATGGAGGGCGGG - Intergenic
1194843037 X:98768484-98768506 GACACACAGGTGTGTATATCTGG - Intergenic
1202174371 Y:22084138-22084160 GACACATACCTGGGCAGGGCAGG + Intronic
1202216989 Y:22502244-22502266 GACACATACCTGGGCAGGGCAGG - Intronic
1202326198 Y:23693826-23693848 GACACATACCTGGGCAGGGCAGG + Intergenic
1202544574 Y:25976228-25976250 GACACATACCTGGGCAGGGCAGG - Intergenic