ID: 1165334804

View in Genome Browser
Species Human (GRCh38)
Location 19:35162245-35162267
Sequence GAGGAGGAAGAGAGGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1007
Summary {0: 1, 1: 0, 2: 7, 3: 117, 4: 882}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165334804_1165334812 12 Left 1165334804 19:35162245-35162267 CCCCAGGGCCTCTCTTCCTCCTC 0: 1
1: 0
2: 7
3: 117
4: 882
Right 1165334812 19:35162280-35162302 TCTTCCACCTAGGAAGGAAATGG 0: 1
1: 0
2: 1
3: 30
4: 244
1165334804_1165334810 2 Left 1165334804 19:35162245-35162267 CCCCAGGGCCTCTCTTCCTCCTC 0: 1
1: 0
2: 7
3: 117
4: 882
Right 1165334810 19:35162270-35162292 TCTTTGCTTCTCTTCCACCTAGG 0: 1
1: 0
2: 2
3: 53
4: 537
1165334804_1165334811 6 Left 1165334804 19:35162245-35162267 CCCCAGGGCCTCTCTTCCTCCTC 0: 1
1: 0
2: 7
3: 117
4: 882
Right 1165334811 19:35162274-35162296 TGCTTCTCTTCCACCTAGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165334804 Original CRISPR GAGGAGGAAGAGAGGCCCTG GGG (reversed) Intronic
900310066 1:2029294-2029316 GAGCTGGAAGGGCGGCCCTGGGG + Intronic
900361800 1:2292739-2292761 GGGGAGGACGTGAGGGCCTGTGG + Intronic
900585358 1:3429991-3430013 GACAAGGAAGAGTGGCCCTGGGG + Intronic
900628845 1:3623297-3623319 GAGGAAGAACAGAGGCCGGGAGG - Intergenic
900680667 1:3914654-3914676 GAGGAGGATGGGAGTCCCAGAGG - Intergenic
900798122 1:4721648-4721670 GAGGAAGAAGAGAGGATGTGTGG + Intronic
900830386 1:4961116-4961138 GAAGAGAAAGAGAAGCCCTCAGG - Intergenic
900969363 1:5980909-5980931 GAGGAGGAAGAGAGACTGAGGGG - Intronic
900970607 1:5990733-5990755 AAGGGAGAAGAGAGGCCCAGAGG + Intronic
901005524 1:6169979-6170001 GCGGAGGACGAGAGGTCCTGGGG + Intronic
901511123 1:9718519-9718541 GAGGGGCATGAGCGGCCCTGGGG - Intronic
901870974 1:12139078-12139100 GAGGAGGCAGGGAGGCCCACAGG - Intronic
902113176 1:14099937-14099959 GAGGAGGAAGAGAGGAAGGGAGG - Intergenic
902255740 1:15187512-15187534 GAGCAGGCAGACAGCCCCTGGGG - Intronic
902287052 1:15413542-15413564 GAGGGGGAAGAGAGGGGATGGGG + Intronic
902631150 1:17705494-17705516 GAGGACTGAGGGAGGCCCTGGGG + Intergenic
902676811 1:18014497-18014519 GAGGAGGAAGAGGAGTCCTGGGG - Intergenic
902935432 1:19761508-19761530 GAGGAGGAACAGGTACCCTGAGG - Intronic
903011053 1:20330716-20330738 GAGAAGGAAGAGGGGCCATCGGG - Intronic
903217774 1:21852647-21852669 GAGGAGGCAGAGAGGCCTCCGGG - Intronic
903548911 1:24143990-24144012 GAGAAGGTAGAAGGGCCCTGGGG + Intergenic
903725102 1:25436092-25436114 GAGGTTCAAGAGAGGCCATGAGG - Intronic
903766792 1:25740280-25740302 GTGGAGGAGGAGAGGCAGTGAGG + Intronic
903846602 1:26282831-26282853 GATGAGGAGGTGAGGGCCTGGGG - Intronic
903942481 1:26941431-26941453 GAGAGGGAAGAAAGGCCATGAGG - Intronic
904027872 1:27516014-27516036 GAGGAGTCAGAGAGGCCAAGAGG - Intergenic
904353638 1:29924677-29924699 TAGGAGGCTGAGAGGCCCTGAGG - Intergenic
904373867 1:30067175-30067197 AAGGAGGAAGAGAGGGCAGGTGG - Intergenic
905864600 1:41369860-41369882 CAGGAGGGAGGGAGCCCCTGGGG + Intronic
905898468 1:41564859-41564881 CAGGAGGCAGAGAGGACCTCCGG + Intronic
906087561 1:43148812-43148834 GTGGAGGGAGAGAGACCTTGAGG - Intronic
906291879 1:44624685-44624707 GAGGAGGAGGAGAGGGCGAGGGG + Intronic
906612511 1:47213226-47213248 GAGGAGGAAATGAGGCCTAGAGG - Intergenic
907336048 1:53700284-53700306 AAGGAGGAGGAGAGACTCTGTGG - Intronic
907386346 1:54128011-54128033 GAGAAGGAAGCCAGGTCCTGTGG + Intergenic
907400539 1:54222338-54222360 CAGCAGGAACAAAGGCCCTGGGG + Intronic
907451462 1:54548201-54548223 GAGGAGCAGGAGAGGCCCACAGG + Intronic
907537016 1:55171972-55171994 GATGAGGAACAGAGGCACTGAGG + Intronic
907784179 1:57595804-57595826 GAGGAGGAAGAGAGGTGGGGAGG - Intronic
908510183 1:64844956-64844978 GGGTAGGAAGAGATGACCTGAGG - Intronic
908962954 1:69723820-69723842 AAGGAGCAAGAGAGTCTCTGGGG + Intronic
910256316 1:85250597-85250619 GAGGAGGAAGACAGGACTTAGGG - Intronic
911071489 1:93835401-93835423 GAGGAGGAAAACTGGCCGTGAGG - Intronic
911100045 1:94088340-94088362 GAGGAGCAAGGGAGGCCCTTGGG - Intronic
911479649 1:98422171-98422193 GAGGAGGCAGTGAGGCCAGGGGG - Intergenic
911712544 1:101091367-101091389 GAGGAGGAAGCGTGGCATTGTGG - Intergenic
912434843 1:109654626-109654648 GAGGCGGAAGTGGTGCCCTGGGG - Intergenic
913167673 1:116203486-116203508 GAGGAGGCAGAGAGGAACGGTGG + Intergenic
913250687 1:116910142-116910164 GAGGAGGAGGAGAGGCGGCGGGG + Exonic
913434276 1:118830991-118831013 GAGAGGGAATATAGGCCCTGGGG + Intergenic
913531702 1:119738325-119738347 GAGGGGGCAGAGAGGCCTGGAGG - Intronic
913548395 1:119893019-119893041 GAGGAGGGAGAGGAGCACTGAGG + Intergenic
915165041 1:153943807-153943829 GATGAGGAAAACAGGCCCAGAGG + Intronic
915273597 1:154772896-154772918 GAGAAGGAAGAGGGGCCCGAAGG + Intronic
915316986 1:155034279-155034301 GAGGAGGATGAGGGAGCCTGAGG - Intronic
915562105 1:156693369-156693391 GAGGAGGAAGAAAGGGCCCCAGG - Intergenic
915590216 1:156866432-156866454 GAGGAGGAGGAGGGGAGCTGAGG + Intronic
915713781 1:157925455-157925477 GAGGAGGGTAAGAGGCCCTATGG + Intergenic
915751151 1:158212517-158212539 GAGGAGGCAGACAGTCCCTGGGG + Intergenic
916163578 1:161943620-161943642 GAGCAGGTATAGAGGCCCTGAGG - Intronic
916493640 1:165325929-165325951 GAGGAGGCAGGCAGGCCCGGGGG - Intronic
916787265 1:168095709-168095731 GAGGAGGAAGACAGCAGCTGAGG + Intronic
916923992 1:169498426-169498448 GAGAAGGAAGGGAAGCCATGAGG + Intergenic
917073095 1:171174565-171174587 AAGAAGGAAGACAAGCCCTGTGG + Intergenic
917235230 1:172884565-172884587 GAGGAGGAAGAGAGGACAGAAGG + Intergenic
917496886 1:175548597-175548619 CAGCAGAAAGAGGGGCCCTGAGG - Intronic
917549275 1:176007401-176007423 TTGGAGGAAGAGAGGCACTCTGG + Intronic
918043621 1:180928052-180928074 GAGGAGGGAGAAAGGGCCCGGGG - Intronic
918450163 1:184650101-184650123 GAGGAGGAAATGAGGGGCTGGGG - Intergenic
919022630 1:192126981-192127003 GAGGAGGAAGAGTGGGACTCTGG - Intergenic
919974901 1:202604034-202604056 GAGGCGGAAGAGTGACCCTGAGG - Intronic
920100815 1:203515926-203515948 GGGGAGGAAGTTAGTCCCTGTGG + Intergenic
920182886 1:204143428-204143450 GAGCAGGGAGGGAGGCCCCGGGG - Intronic
920214377 1:204351446-204351468 GCGGAGGGTGAGAGGGCCTGGGG - Intronic
920364469 1:205440745-205440767 GAGGAGGATGAGAGGCACACAGG + Intronic
920436937 1:205953184-205953206 GGGGAGGAAGAGGTGTCCTGGGG + Intergenic
920526842 1:206673495-206673517 GAGAGGGAAGAAAGGCCTTGGGG - Intronic
920825857 1:209423802-209423824 GAGGAGAAAGGTAGGCCCTGGGG + Intergenic
921993191 1:221389697-221389719 GAGCAGGTAGAGAAGCCATGTGG + Intergenic
922559086 1:226555028-226555050 GAGGAGGGAGTGAGCCCCTATGG - Intronic
922822424 1:228493589-228493611 GAGGCAGAAGAAAAGCCCTGAGG - Intronic
922950860 1:229558087-229558109 GTGGAGAAGGAGAGGCCCGGCGG + Intronic
923555684 1:234998786-234998808 GAGGAAGAACAGAGGCCCAAAGG - Intergenic
923865792 1:237938164-237938186 GAGCAGGCACGGAGGCCCTGGGG + Intergenic
923936415 1:238765228-238765250 GAGGAGGAAGAGGTCACCTGTGG + Intergenic
924292033 1:242546497-242546519 GAGGAGGAAGAGAGGCTGAGAGG + Intergenic
924616184 1:245613763-245613785 GAGTAGGAAGAGAGGCACCGAGG - Intronic
924633107 1:245760914-245760936 GAGGAGTAAGCGAGGCAATGCGG - Intronic
924769256 1:247064566-247064588 GAAAAGGCAGAAAGGCCCTGTGG - Intronic
924795685 1:247290632-247290654 GAGGATGGAGAGAGGCCGTCTGG + Intergenic
1062796826 10:351123-351145 GCGCAGGGAGAGAGGCCCAGAGG + Intronic
1062871129 10:905671-905693 GAGGAGCAAGGGAGGAGCTGAGG + Intronic
1062871133 10:905690-905712 GAGGAGCAAGGGAGGAGCTGAGG + Intronic
1062998564 10:1891952-1891974 GAGGAGGCAGAGAAACCCAGTGG - Intergenic
1063002622 10:1939133-1939155 GAGGGGGAAGAGAGGCTCACAGG - Intergenic
1063218934 10:3948604-3948626 GAAAAGGACTAGAGGCCCTGGGG - Intergenic
1064016840 10:11779435-11779457 GAGGGGCAAGGGTGGCCCTGGGG + Intergenic
1064022896 10:11823671-11823693 GAGGAGGCAGCGACGCCCCGGGG - Intronic
1065807541 10:29408977-29408999 GAGGAGGAAGAGTTGGTCTGAGG + Intergenic
1065866492 10:29919413-29919435 GAGGAGGAAGAGAGGGTAAGAGG - Intergenic
1065894927 10:30154815-30154837 CAGGAGGAAGAGAGGGAGTGGGG + Intergenic
1066262129 10:33739210-33739232 TAGGAGGAAGTGAGACTCTGGGG - Intergenic
1067067895 10:43113804-43113826 GTGGAGTAACAGAGGCCCAGAGG - Intronic
1067069099 10:43119525-43119547 GATGAGGAGGAGCGGGCCTGGGG - Exonic
1067182123 10:43996261-43996283 GCGGAGGAAGAGAAGCCCACGGG + Intergenic
1067310312 10:45106784-45106806 GAGGAGGATGAGAGTTTCTGTGG - Intergenic
1067536580 10:47114872-47114894 CAGGAGGCAGGGAGGCCCTGGGG + Intergenic
1067703931 10:48593000-48593022 AAGGAGGCCGAGAGGCCGTGTGG - Intronic
1067863369 10:49876646-49876668 GAGGAGGAATAAAAGCCATGTGG + Intronic
1068229268 10:54149935-54149957 GGGGAGGAAGAGGGGCATTGAGG + Intronic
1068558179 10:58481933-58481955 GAGGAGGAAGGGAGGGGATGAGG - Intergenic
1068571293 10:58632385-58632407 GAGGGGGAAGGGTGGCCCTATGG + Intronic
1069832303 10:71288839-71288861 GTGGGGGGACAGAGGCCCTGAGG - Intronic
1069836072 10:71308958-71308980 GAGGAGGAGAAGAGGCAGTGTGG - Intergenic
1069873580 10:71547954-71547976 GAGCCGGAAGAGAGGCCCCGTGG + Intronic
1069877954 10:71574644-71574666 GAGGAGGACGTGGGTCCCTGAGG + Intronic
1069886828 10:71629048-71629070 AACAAGGAAGAGATGCCCTGAGG + Intronic
1069891129 10:71653087-71653109 GAGGGGGAAGTGAAGTCCTGGGG - Intronic
1069891189 10:71653361-71653383 GAGCAGAGGGAGAGGCCCTGTGG - Intronic
1069940067 10:71949182-71949204 TATGAGGGAGAGAGACCCTGGGG + Intergenic
1070726575 10:78795693-78795715 GAGAAGGAAGAGAGGGATTGGGG - Intergenic
1070782389 10:79145283-79145305 GAGGAGGGAGAGAAGACCTCAGG - Intronic
1071321752 10:84466952-84466974 GAGGAGGAAGAGATGCAGTTAGG - Intronic
1071475668 10:86023150-86023172 TTGGAGAAATAGAGGCCCTGCGG + Intronic
1071480029 10:86058160-86058182 GGGGAGGAAGGGGGGCCCAGGGG - Intronic
1071561952 10:86651950-86651972 GAGGAGGAGGAGAAGTGCTGAGG + Intergenic
1071875581 10:89839270-89839292 GAGATGGCTGAGAGGCCCTGTGG + Intergenic
1072122707 10:92418709-92418731 GAGATGGCTGAGAGGCCCTGCGG - Intergenic
1072370085 10:94757492-94757514 TTGGAGGAAAAGAGGCCATGTGG + Intronic
1072477514 10:95777194-95777216 TTGGAGGAAAAGAGGCCCTCTGG + Intronic
1072978406 10:100079099-100079121 GAGGAGCAGGAGAGGCACTCAGG - Intronic
1073205505 10:101767337-101767359 GAGGAGGAACCCAGGCCCAGTGG - Intergenic
1073229831 10:101959681-101959703 GAGGAGGAAGAGAGCAACTCTGG + Intronic
1073543280 10:104329005-104329027 GGAGAGGAAGAGAAGCGCTGTGG + Intronic
1074109256 10:110410869-110410891 GAGGAGGAAGACAGGGCCCCAGG - Intergenic
1074443729 10:113500788-113500810 GAGGAGGGAGTGAGGCCTTGGGG - Intergenic
1075015971 10:118910292-118910314 GAGGCGGAGGAGAGGGGCTGGGG - Intergenic
1075159206 10:120008625-120008647 GATGAGGAAGAGAGGCTCAGGGG - Intergenic
1075199421 10:120389773-120389795 GGGAAGGAAGAAAGGCCCTCTGG + Intergenic
1075208227 10:120465349-120465371 GAGGAGGCTGAGAGGACCTGGGG + Intronic
1076221696 10:128739047-128739069 CAGGAGGCAGAGAGCCCATGGGG - Intergenic
1076403117 10:130196049-130196071 GGGGAGGATGAGAGGCCCAGTGG - Intergenic
1076461008 10:130647442-130647464 CAGGAGCAGGAGTGGCCCTGTGG - Intergenic
1076469683 10:130709856-130709878 CAGGAGGCAGACAGGCCTTGGGG + Intergenic
1076546774 10:131250687-131250709 TAGGAGGAAGAGAGGCTAAGAGG - Intronic
1077210776 11:1370100-1370122 GAGGAGGAGGAGGGGCGGTGAGG + Intergenic
1077322461 11:1948383-1948405 GAGGAGGAAGTGAGGGTCAGAGG + Intronic
1077322732 11:1949561-1949583 GAGGAGGAAGTGAGGGTCAGAGG - Intronic
1077548069 11:3185083-3185105 CAGGAGGAAGAGAGGCCAGAGGG + Intergenic
1077846864 11:6034449-6034471 GAGGAGGAACTGTGTCCCTGGGG + Intergenic
1077862750 11:6198038-6198060 TGGGAGGGAGAAAGGCCCTGAGG + Intergenic
1077892296 11:6427992-6428014 GGGAAGAAAGAGGGGCCCTGGGG + Intergenic
1077896643 11:6458000-6458022 GAGGAGGAGGAGAGGCATTGGGG - Intronic
1078088879 11:8251538-8251560 GACTGAGAAGAGAGGCCCTGGGG + Intronic
1078098058 11:8312591-8312613 GAGGGTGAAGAGAGGTGCTGTGG + Intergenic
1078131383 11:8616936-8616958 AAGCAGGAGGAGAGGCCCAGAGG + Exonic
1078699639 11:13668522-13668544 GAGGAGGATGACTGGTCCTGCGG + Intergenic
1078929919 11:15905203-15905225 AGGGAGGCAGAGAGGCTCTGGGG - Intergenic
1078936713 11:15957665-15957687 GAGGAGGAAGAGAAAGCCTAAGG + Intergenic
1079243939 11:18739811-18739833 GAGGAGGAAGGAAGGGGCTGAGG - Intronic
1080164774 11:29224019-29224041 GAGGAGGAGAAGAGGCACTCTGG + Intergenic
1080290638 11:30667178-30667200 GAGTAGGAAGAGATGAGCTGAGG + Intergenic
1080692093 11:34566687-34566709 GAGGAGAAAGAGAGGTTCTGAGG + Intergenic
1080807046 11:35663034-35663056 GAGGAGGAAGTGAGGCCGCGCGG + Exonic
1081272032 11:41096650-41096672 GAGAAAGAAGAGAGGCCAGGAGG + Intronic
1081420680 11:42872795-42872817 GATGAGGAAAAGAGCACCTGGGG + Intergenic
1081484456 11:43516741-43516763 GAGGTGACAAAGAGGCCCTGAGG - Intergenic
1081492398 11:43578809-43578831 GAGGTGGAAATGAGGCCATGGGG - Intronic
1083399993 11:62416936-62416958 GAGGGGGAAGAGAGGCCCATGGG + Intronic
1083404606 11:62447952-62447974 GAGGATGCTGAGAGGGCCTGTGG + Intronic
1083610771 11:64003145-64003167 GAGGAGGCAGAGGGGCCTTAGGG - Intronic
1083674123 11:64316110-64316132 GAGGGGGAGGAGAGGGCGTGGGG - Exonic
1084092213 11:66886167-66886189 GAGGAGGAAGGGACGTCCAGAGG + Intronic
1084171630 11:67403932-67403954 GAGGAGGAGGTGAGGTGCTGCGG + Intronic
1084174760 11:67417461-67417483 CTGGAGGAAGAGGGCCCCTGGGG + Exonic
1084670383 11:70603354-70603376 GAGGAGGAAGGGAAGCCTGGAGG - Intronic
1084671400 11:70608660-70608682 AAGCAGGGAGAGAGGCCCTGAGG - Intronic
1084863981 11:72041025-72041047 GAGGAGGAAGGGGGGGCCAGTGG + Intronic
1084947174 11:72644372-72644394 AAATAGGAAGGGAGGCCCTGTGG - Intronic
1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG + Intronic
1085279366 11:75320116-75320138 GAGGAGGAAGAGAAGAGGTGAGG + Intronic
1085282986 11:75342795-75342817 CAGCAGGAACAAAGGCCCTGAGG + Intronic
1085406471 11:76266053-76266075 GAGGAGGAGAAGAGGGTCTGGGG + Intergenic
1086168293 11:83806043-83806065 GAGGAGGAAGTTAGGCCCAAGGG - Intronic
1089085633 11:115814833-115814855 GGGGAGAAAGAGAGACCATGTGG - Intergenic
1089182188 11:116590639-116590661 AAGGAGTAAGAGAGGTCATGGGG - Intergenic
1089223325 11:116894088-116894110 GAGGAGGGAGTGAGGAGCTGTGG - Intronic
1089502415 11:118940366-118940388 GCTGAGGTAGAGAGGCCCCGGGG + Intronic
1089587996 11:119522168-119522190 GATGAGAAACAGAGGGCCTGGGG + Intergenic
1089780414 11:120869736-120869758 CTGGAGGAAGAGGGGGCCTGGGG + Intronic
1089845716 11:121456411-121456433 CTGGAAGAAGAGAGGCCCAGAGG + Intronic
1089974885 11:122723823-122723845 AAGGAGGCAGGGTGGCCCTGGGG + Intronic
1090035738 11:123248051-123248073 GAAGAGGACGAGGGGCCATGTGG - Intergenic
1090258593 11:125303024-125303046 ATGGAGGAATAGAGGCACTGTGG - Intronic
1090274564 11:125410369-125410391 GAGGAGAAAGGGTGGCCCCGAGG + Intronic
1090341972 11:126031868-126031890 AAGGAGGAAGAGAAGCCTTGAGG - Intronic
1090358990 11:126159902-126159924 GTGGTGGCAGATAGGCCCTGGGG - Intergenic
1090422255 11:126583542-126583564 GAGGAGGACGGGATGCGCTGTGG + Intronic
1090993370 11:131840849-131840871 AAGGAGGAAGTGAGGCCATCGGG + Intronic
1091177122 11:133570508-133570530 GATGTGGAAGAGAGGACATGAGG - Intergenic
1091215784 11:133900624-133900646 GAGGAGGGAGAGATGAACTGTGG - Intergenic
1091224361 11:133948805-133948827 CAGGAGGAACAGAGGCCTAGGGG + Intronic
1202805479 11_KI270721v1_random:3696-3718 GAGGAGGAAGTGAGGGTCAGAGG + Intergenic
1202805750 11_KI270721v1_random:4874-4896 GAGGAGGAAGTGAGGGTCAGAGG - Intergenic
1091400340 12:177354-177376 GAGGTGGGAGGGAGGGCCTGGGG - Exonic
1091874481 12:3922357-3922379 GAAGAGGAAAAGAGGTGCTGGGG - Intergenic
1091900920 12:4143191-4143213 GGGGAGGAACAGAGTCCTTGAGG - Intergenic
1092159508 12:6308404-6308426 GAGGCTGAAGACAGGCCCTGGGG + Intergenic
1092564682 12:9651542-9651564 CAGGAGGAAGAGAGGAAGTGAGG + Intergenic
1092613333 12:10194014-10194036 GAGGAAGGAGAGAGACCTTGCGG + Intergenic
1096227709 12:49877176-49877198 GAGGAGGTGGAGAAGCCCTGGGG - Intronic
1097081298 12:56433143-56433165 TAAGAGGAAGAGACTCCCTGTGG + Intronic
1097247725 12:57615781-57615803 GAGGAGCCAGGGAGGGCCTGAGG + Intronic
1097492007 12:60282553-60282575 CAGGAGGCAGACAGGCTCTGGGG - Intergenic
1097990068 12:65824923-65824945 GAGAAGGAAGAGAGGCTTTGAGG - Exonic
1098116904 12:67188620-67188642 GAGAAGGAAGGGAAGCCATGAGG - Intergenic
1099240407 12:80131393-80131415 GAGGAGAGTCAGAGGCCCTGAGG + Intergenic
1099467879 12:83009345-83009367 CAGGAGAAAGAGAAACCCTGAGG - Intronic
1099576526 12:84390598-84390620 GAGGTGAAGGAGGGGCCCTGCGG + Intergenic
1099643777 12:85324506-85324528 GAGGAAGAAGAGAGCTCCTCTGG + Intergenic
1099868986 12:88322342-88322364 CAGGAGGAAGAGAGAGCATGGGG + Intergenic
1101212090 12:102544698-102544720 CAAAAGGAAGAGATGCCCTGTGG + Intergenic
1101412322 12:104479888-104479910 GAAGAGGGAGAGAGGTCCAGCGG + Intronic
1101802638 12:108035589-108035611 GAGGAGGAAGAAATCCCATGAGG + Intergenic
1102016297 12:109650129-109650151 GAGATGGCACAGAGGCCCTGAGG + Intergenic
1102175891 12:110874512-110874534 GAGGAGGAAGTGGGGCCTTCAGG + Intronic
1102493472 12:113303486-113303508 GGGGAGGAAGAGATGGCCTGGGG - Intronic
1102710783 12:114924752-114924774 AAGGATTAAGAGAGGCCCTTAGG + Intergenic
1103073637 12:117965121-117965143 GAGGAGGAAGAGATGTCCTGGGG + Intronic
1103415485 12:120739628-120739650 GAGGAGGCGGAAAGGCCCAGAGG - Exonic
1103893018 12:124254122-124254144 GAGGAGGACAAGAGGCCACGTGG - Intronic
1103932396 12:124457688-124457710 GAGGAGGCGGGGAGGCCCCGGGG - Intronic
1104049507 12:125186309-125186331 GAGGAGGAGGAGAGGAGCGGAGG - Intergenic
1104170822 12:126278584-126278606 GGGGAGAGAGAGAGGACCTGTGG - Intergenic
1104328728 12:127824583-127824605 GAGGAGGAAGAGAAGTGCTGGGG - Intergenic
1104955869 12:132465549-132465571 CAGGTGGCCGAGAGGCCCTGGGG - Intergenic
1104970157 12:132527430-132527452 CAGGAGGACGACAGCCCCTGGGG + Intronic
1105065414 12:133193097-133193119 GAAGAGCAAGAGAAGCCCAGTGG - Intronic
1105438691 13:20398480-20398502 GAGGAGGATTACAGGCCCTTGGG - Intergenic
1105580800 13:21693767-21693789 GAAGAGAAGGAGAGCCCCTGGGG + Intronic
1106033325 13:26021978-26022000 CAGGATGCAGAGAGGGCCTGAGG + Exonic
1106342240 13:28841508-28841530 GAGAAGGAAGAGATGACATGTGG + Intronic
1106414902 13:29538364-29538386 GAGCAGGAAAAGGGCCCCTGAGG + Intronic
1106583346 13:31036384-31036406 GAGGAGGAAGAGAGGGCAGTGGG - Intergenic
1106717945 13:32410265-32410287 CAGAAGGATGACAGGCCCTGCGG - Intronic
1106911831 13:34471351-34471373 GAGGAGCAAGGGAGGACCTCCGG + Intergenic
1107392491 13:39981803-39981825 GTGGAGAAAGAGAGGCCCTGAGG - Intergenic
1107464674 13:40638683-40638705 GAGGAGGAGGAGGGGGCCTAAGG + Intronic
1107554072 13:41502280-41502302 GAGGAGGCAAAGAGGCTGTGAGG - Intergenic
1109376434 13:61500342-61500364 GAGGAAGATGACAGGCACTGGGG + Intergenic
1110102492 13:71627044-71627066 TAGGAGGAAGTGAGCACCTGAGG - Intronic
1110720138 13:78752199-78752221 CAGGAGGAAGAGAGACAATGGGG - Intergenic
1111399184 13:87710017-87710039 GAGGAGGAAGAGAGGAAGGGAGG - Intergenic
1112029907 13:95447599-95447621 GAGGCAAAGGAGAGGCCCTGGGG - Intronic
1112295584 13:98183941-98183963 GAGGGTGAAGAAAGGGCCTGGGG - Intronic
1113098900 13:106695886-106695908 GAGGAGGGAAAGAGGCCAAGAGG + Intergenic
1113200927 13:107867111-107867133 GAGGAGGAGGGGAGGCGCTCCGG - Intergenic
1113214465 13:108022340-108022362 TTGGAGGATGAGAGGCCATGGGG + Intergenic
1113453894 13:110433431-110433453 CAGGAGGCAGAGAGGGACTGTGG + Intronic
1113490178 13:110685406-110685428 GATGAGCACGTGAGGCCCTGAGG - Intronic
1113499010 13:110758711-110758733 GAGGAGGAAGAGGGTCTGTGGGG - Intergenic
1113610757 13:111643475-111643497 GAAGAGGAAGCGAGGTGCTGAGG + Intronic
1113640979 13:111956451-111956473 GAGGAAGAAGAGAGAAGCTGAGG - Intergenic
1113964333 13:114144217-114144239 GAGGCTGAAGGGAGGCCATGGGG + Intergenic
1114272235 14:21107986-21108008 GAGGAGGAAGAGAGGAGGAGGGG + Intergenic
1114304223 14:21406422-21406444 ATGGAGGATGAGAGGCCATGTGG + Intronic
1114549855 14:23526478-23526500 GAGGAGGAAGAGGGGACCACTGG - Exonic
1114613406 14:24056225-24056247 GAGGAGGAGGGGAAGCCCAGAGG + Intronic
1114634284 14:24178626-24178648 GAGGACCATCAGAGGCCCTGCGG + Exonic
1116442703 14:44972008-44972030 AAGGAGGAAGAGAGGGCAGGAGG + Intronic
1117056907 14:51921566-51921588 AAGGAAGAAGAGAGTCCCTGTGG - Intronic
1117500398 14:56345466-56345488 CAGGAGGAAGACAGGCCGAGGGG + Intergenic
1117833690 14:59779828-59779850 GGGGAGGAAGAAAAGCCATGAGG - Intronic
1117909584 14:60624299-60624321 GTGGAGAAAGAGGGGCCCTGGGG - Intergenic
1118589571 14:67391412-67391434 GGGGAGGAAGAGAGGCCCCTAGG - Intronic
1119642798 14:76327595-76327617 GAGGAGAAAGATGGGCCCTGGGG + Intronic
1119752563 14:77090237-77090259 GAGGAGGAAGCCAGGCACGGTGG + Intergenic
1119914232 14:78382298-78382320 GAGGTGGAAGAGAGGATTTGTGG + Intronic
1120824940 14:88946479-88946501 GAGGAGGAGGAGATGCCCAACGG + Intergenic
1121104184 14:91270131-91270153 GAGGAGGAAGAGAGGGAAGGAGG - Intergenic
1121110783 14:91311463-91311485 GAGGAGGAAGAGAGAGAGTGAGG - Intronic
1121994946 14:98594401-98594423 GAGGGTGAAGAGCGGCACTGGGG + Intergenic
1122114470 14:99520770-99520792 GAGGAGGAAGTGAGGCTCACAGG - Intronic
1122187418 14:100010926-100010948 GAGAATGCAGAGAGGCACTGAGG + Intronic
1122391925 14:101395334-101395356 GAGGAGGTAGAGAGGGCCCCAGG - Intergenic
1122902291 14:104786892-104786914 GAGAATGCAGAGAGGCCCTTCGG - Intronic
1123997745 15:25730466-25730488 CATGGGGAAGAGTGGCCCTGGGG - Intronic
1124679232 15:31715404-31715426 GAGGGGGAAGGGAAGCACTGTGG - Intronic
1124844678 15:33279031-33279053 GAGGAGGCAGAAACCCCCTGGGG + Intergenic
1124995043 15:34715484-34715506 GAGAAGGAAGAGAAGTGCTGAGG - Intergenic
1125088723 15:35764910-35764932 GAGGAGTTAGAGAGGCACTGGGG + Intergenic
1125512988 15:40302782-40302804 GATGGGAAGGAGAGGCCCTGAGG + Intronic
1125686828 15:41568475-41568497 GAGGAGGAAAGGATTCCCTGGGG - Intronic
1125727667 15:41876367-41876389 GAGGAGGAAAACAGGGGCTGTGG - Intronic
1126241766 15:46453294-46453316 TAGGAGGAAGAGAGGAAGTGAGG - Intergenic
1126321471 15:47428926-47428948 GAGGAGGAAGAGAGGGAGGGAGG + Intronic
1126454272 15:48844208-48844230 GAGGAGGAGGAGATAACCTGAGG - Intronic
1126473958 15:49046592-49046614 GAGGAGGCAGAGAGGGGCAGTGG + Intergenic
1126503835 15:49380099-49380121 GGGAAGAAAGAGAGGTCCTGTGG - Intronic
1126859801 15:52872721-52872743 AGGAAGGAAGAGAGGTCCTGCGG - Intergenic
1128310812 15:66630934-66630956 GAGGTGGGACAGAAGCCCTGTGG + Intronic
1128496380 15:68200829-68200851 GGGGATGAAGCGAGGGCCTGGGG - Intronic
1128557815 15:68643538-68643560 GAGCAGGGAGACTGGCCCTGTGG + Intronic
1128598096 15:68972253-68972275 GAGGAAGGAGAGATGGCCTGAGG - Intronic
1128729511 15:70011261-70011283 GATGAAGAAGAGGGGCCCGGTGG + Intergenic
1128739537 15:70074150-70074172 GAGGAGGCAGACAGGCCCCGGGG + Intronic
1128992581 15:72272843-72272865 GAGAAGGAAGAGGGACTCTGGGG + Intronic
1129270327 15:74416084-74416106 GAGGAGGAAGGCAGGCTGTGAGG + Intronic
1129320809 15:74773650-74773672 AAGCAGGAAAAGAGGCCCTGGGG - Intergenic
1129880545 15:79003707-79003729 GAGCAGGAAGAGCAGCCCTGAGG + Intronic
1129892796 15:79082634-79082656 GTGGAGGAAGAGAGGGACAGAGG + Intronic
1130053356 15:80502460-80502482 CAGGAGGAGGAGAGACCCAGAGG + Intronic
1130094241 15:80844270-80844292 GCGCAGGCAGAGAGGCCCCGAGG - Intronic
1130146772 15:81280402-81280424 GCAGAGGCAGAGAGACCCTGTGG + Intronic
1130866444 15:87937044-87937066 AAGGAGGAGCAAAGGCCCTGGGG - Intronic
1130919068 15:88328969-88328991 GCAGAGGAAGAAAGACCCTGAGG + Intergenic
1131138480 15:89958063-89958085 GAAGGGGCAGAGAGGCCCTCCGG - Intergenic
1131152237 15:90054355-90054377 GAGGAGGAAGGGAAGCCATGAGG + Intronic
1131157448 15:90083929-90083951 GAGGAGGTAGTGGGACCCTGAGG - Exonic
1131228786 15:90645914-90645936 GAGGAGGAAGAGTGGCGTGGTGG - Intergenic
1131265278 15:90911920-90911942 GAGGAGGGGCAGAGGCCCAGCGG + Intronic
1131683266 15:94745830-94745852 GAGCAGGAAGAGAGGCCAGTGGG - Intergenic
1131720482 15:95163192-95163214 GAGGAGGAAGAGAAGGCCAAGGG - Intergenic
1132286660 15:100668472-100668494 GAGGAGGAAGGGATGGCCCGAGG - Intergenic
1132329930 15:101005177-101005199 GGAGAGGCAGACAGGCCCTGTGG + Intronic
1132400293 15:101501086-101501108 GAAGAGGCAGAGGGGCACTGTGG + Intronic
1132582887 16:693612-693634 AAGGAGGAGGAGAGGCCGCGTGG + Exonic
1132695656 16:1200666-1200688 GAGGAGGAGGAGGGGTCGTGCGG + Intronic
1132880561 16:2160074-2160096 GTGGAGGCAGCGAGGCGCTGAGG + Intronic
1132931915 16:2462940-2462962 GAGGTGGGAGAGCTGCCCTGAGG - Intronic
1132955947 16:2593608-2593630 GAGGATGGGGAGAGGCCGTGGGG + Intronic
1133089726 16:3394771-3394793 GAGGAAGAAGGGAGGGCTTGTGG - Intronic
1133266693 16:4589085-4589107 GTGGAGGAGGAGAGTCTCTGAGG - Intronic
1133557296 16:6917756-6917778 GAGGAGGAGAACAAGCCCTGAGG - Intronic
1134134618 16:11670384-11670406 GAGGAGGCAGCGTGTCCCTGGGG + Intronic
1134719148 16:16371272-16371294 GAGGTGGCAGCCAGGCCCTGGGG - Intergenic
1134746722 16:16594364-16594386 GAGGAGGAAGACAGGACGTTGGG - Intergenic
1134948279 16:18340613-18340635 GAGGTGGCAGCCAGGCCCTGGGG + Intergenic
1134993643 16:18722480-18722502 GAGGAGGAGGAGAGGAGATGGGG + Intergenic
1134998751 16:18759302-18759324 GAGGAGGAAGACAGGACGTTGGG + Intergenic
1135398585 16:22149759-22149781 GAGGAGGAAAAGAGGAGGTGAGG - Intronic
1135603614 16:23804008-23804030 GAGGAGGAAGAGAGGGGTAGAGG - Intergenic
1135754654 16:25087000-25087022 GAGGAGGCAGAGAGGTGCTTTGG + Intergenic
1136102878 16:28008539-28008561 GGGGAGGCAGGGAGGCCATGAGG - Intronic
1136459385 16:30400276-30400298 GAGGAGGAAGAGGGGGCGTGTGG + Intergenic
1136556572 16:31010685-31010707 GAGGAGGAAGCGAGGGCGGGGGG + Intergenic
1137714869 16:50592454-50592476 GAGGAGGAAGAGAGGGTTAGCGG + Intronic
1138006212 16:53340309-53340331 GAGGAGTGAGAGAGGCCCAAGGG - Intergenic
1138062594 16:53907626-53907648 GAGGAGGAAAAGATGGGCTGAGG - Intronic
1138304558 16:55962606-55962628 GAGCAGGGAGAGAGGGCCAGGGG - Intergenic
1138319940 16:56103237-56103259 TAGCTGGAAGCGAGGCCCTGAGG + Intergenic
1138500786 16:57442578-57442600 GGGGTGGAGGAGAGGGCCTGAGG + Intronic
1138505194 16:57475041-57475063 GAGGAGGAAGAGAGGAAGGGAGG - Intronic
1138532512 16:57642330-57642352 GATGATGATGAGTGGCCCTGGGG + Intronic
1138583893 16:57958320-57958342 GAGGAGGATGGTTGGCCCTGTGG - Intronic
1139040797 16:62997406-62997428 TTGGAGGAAGAGAGGCGCTCTGG + Intergenic
1139264077 16:65623158-65623180 GAGGAGGAGGTGAGGTCCTGGGG + Intergenic
1139356371 16:66369185-66369207 GAGGAGGAAGTGGGACCCAGGGG + Intronic
1139547645 16:67657162-67657184 GAGGTGGAAGAGAGGGGCAGGGG + Intronic
1139570203 16:67806872-67806894 GGGGATGAACAGAGGCCATGGGG - Intronic
1139603553 16:68001585-68001607 GAGGAGGCAGGAGGGCCCTGGGG + Intronic
1139912867 16:70408957-70408979 GAGGAGGAAGCTGGGCCCTGAGG + Intronic
1140185490 16:72766490-72766512 GAAGAGGAAAAGATGTCCTGTGG + Intergenic
1140485083 16:75287363-75287385 TAGGAGGGAGAGAGGCCCCAAGG + Intergenic
1140848342 16:78911077-78911099 GAACAAGAAGGGAGGCCCTGGGG - Intronic
1141042571 16:80684642-80684664 GAGAAGGATGAGAGGCACTTTGG - Exonic
1141229311 16:82149953-82149975 GAGTTGGAGGAGAGACCCTGTGG - Intronic
1141435246 16:83996180-83996202 GAGGATGAGGAGAGGCACTGTGG - Intronic
1141526280 16:84614056-84614078 GAGGAGGAGGAGAGGCTGTTTGG + Intronic
1141675236 16:85514182-85514204 GAGGAGGAAGAGAGGGGAGGGGG - Intergenic
1141974136 16:87503507-87503529 GAGGGGGAAATCAGGCCCTGGGG + Intergenic
1142077315 16:88127636-88127658 GAGGCGGCAGGGAGGGCCTGGGG + Intergenic
1142090518 16:88207096-88207118 GAGGGGGAGGGGAGGCCGTGGGG + Intergenic
1142289657 16:89187754-89187776 GAGTTGGGAGAGAGGCCCTTGGG + Intronic
1142496035 17:306807-306829 GGGGAGGAAAAGAGGCCCTGAGG - Intronic
1142820486 17:2462628-2462650 GAGGAGGAAGAGAGGGAAGGAGG - Intronic
1142893333 17:2959163-2959185 GAGAAGGAAGAGAGGATCTGAGG - Intronic
1143163094 17:4884255-4884277 GAGGAGGATAAGAGACCTTGGGG - Intronic
1143319111 17:6056475-6056497 GAGCAGGCAGAGATGCACTGGGG + Intronic
1143337926 17:6187418-6187440 CTGCAGGAGGAGAGGCCCTGTGG - Intergenic
1143448333 17:7021719-7021741 GAGGAGGGAGAGAGGGCAGGAGG - Intergenic
1143706206 17:8699141-8699163 CAGGAGGGAGATAGGGCCTGGGG + Intergenic
1144050498 17:11493735-11493757 GAGTTGGAAGAGAAGCCCAGGGG - Intronic
1144785380 17:17828375-17828397 GAGGAGGAAACGTGGCTCTGAGG - Intronic
1144825421 17:18103101-18103123 CAGCAGGAGGAGAGGACCTGAGG - Intronic
1144835110 17:18152706-18152728 GGGGAGGAAGAGAGGAGATGAGG - Intronic
1145126266 17:20302392-20302414 GTGGGGGAAGTGAGGCCCTTCGG + Intronic
1145942469 17:28749804-28749826 AAGAAGGGAGACAGGCCCTGGGG - Exonic
1146163076 17:30570342-30570364 GGGCAGGAAGAGAGGCCCCCAGG - Intergenic
1146399552 17:32492403-32492425 GAGGAGGGAAGGAGGCCGTGGGG - Intergenic
1146620289 17:34391805-34391827 GATGAGGAAGAGGGGCGATGGGG + Intergenic
1147164702 17:38587029-38587051 GAGGAGGAAGAGCTGGGCTGGGG - Intronic
1147303931 17:39550317-39550339 GTGGAGGAAGGGAGGCACTGGGG + Intronic
1147580061 17:41623111-41623133 GGGCGAGAAGAGAGGCCCTGAGG - Intronic
1147597062 17:41724250-41724272 TGGGAGGAAGAGAGGCCTTCTGG - Exonic
1147738087 17:42653637-42653659 GAGGAAGCTGAGAGGCTCTGCGG + Intergenic
1148192968 17:45692696-45692718 CAGGAGGAAGATGGACCCTGAGG + Intergenic
1148208025 17:45791726-45791748 GGGGAGGAGGAGCAGCCCTGGGG - Intronic
1148329620 17:46805964-46805986 GATGAGAAACTGAGGCCCTGAGG - Intronic
1148492056 17:48029543-48029565 AGTTAGGAAGAGAGGCCCTGGGG + Intronic
1148550860 17:48550282-48550304 GGGGAGGAAGAGAGAGACTGTGG - Exonic
1148561020 17:48606167-48606189 GAGCGGGAAGAGAGGCTCGGAGG + Intergenic
1148564918 17:48626925-48626947 GAAGAGGAAATGAGGGCCTGCGG - Intronic
1148683469 17:49487535-49487557 GAGCAGGAGCAGAGGCCATGTGG + Intergenic
1148806716 17:50267482-50267504 GAGGAGGAAGAGGGGTTGTGAGG + Intergenic
1150137005 17:62701620-62701642 GAGGAGGGAGGGAGGCACTTGGG + Exonic
1150562237 17:66303374-66303396 GGGGAGGAGGAGAGGCCCTAAGG + Intronic
1150645620 17:66975949-66975971 AAGGAGGCAGAGAGGAACTGGGG + Intronic
1151372833 17:73659772-73659794 GAGGAAGACGAGAGGACATGAGG - Intergenic
1151386371 17:73757779-73757801 GAAGAGGAGGAGAGGCCCGTGGG - Intergenic
1151430577 17:74059802-74059824 GAGGAGGATCACAGGCCTTGTGG + Intergenic
1151541723 17:74768071-74768093 GAGGAGGGAGGGAGCTCCTGGGG - Intronic
1151763968 17:76122596-76122618 GCGGAGGCAGAGCGGCCCTGGGG + Intergenic
1152068674 17:78124788-78124810 GCACAGGCAGAGAGGCCCTGAGG + Intronic
1152110782 17:78356664-78356686 GAGGAGGAAGAGAGCCGCAGAGG - Intergenic
1152140654 17:78534541-78534563 GAGCAGAAAGAGGGGCCATGAGG - Intronic
1152151385 17:78603495-78603517 GTGGAGGCAGAGAGCTCCTGGGG + Intergenic
1152164528 17:78693755-78693777 GTGGAGGAAGAGAAAGCCTGTGG - Intronic
1152245680 17:79183474-79183496 GAGGGGGAGGGGAGGCCCAGAGG - Intronic
1152261559 17:79269972-79269994 GAGAAGCAGCAGAGGCCCTGAGG - Intronic
1152366740 17:79860745-79860767 GAGAAGGAAGAGAGGGACAGAGG - Intergenic
1152401877 17:80071327-80071349 GAGGAGGCTGTGAGGCCGTGTGG - Intronic
1152864253 17:82712839-82712861 CAGGAGGCAGAGAGGCTCTTGGG - Intergenic
1154337416 18:13476701-13476723 GAGGAGACAGAGAGGGCCTAGGG - Intronic
1156504958 18:37584542-37584564 GAGGAGAAGGAGAGGCTCTCAGG - Intergenic
1157042922 18:44061239-44061261 CAGGAGGCAGACAGGCTCTGGGG - Intergenic
1157220549 18:45825898-45825920 GAGGAGGAAGAGCTGCGCTTGGG + Intronic
1157951638 18:52044674-52044696 GAGGAGAAAGAGTGGCACTGAGG + Intergenic
1158330703 18:56358987-56359009 GAGCTGGAGGAGAGGCCCAGTGG + Intergenic
1158390933 18:57044378-57044400 GAGGAGTAAGAGAAGGCATGAGG + Intergenic
1158434757 18:57428056-57428078 TAGCACGGAGAGAGGCCCTGGGG + Intergenic
1160103761 18:75949113-75949135 GAGGAGCAACAGAAACCCTGTGG + Intergenic
1160128171 18:76198655-76198677 GAAGAGGAAGAGAAAACCTGTGG + Intergenic
1160208432 18:76857026-76857048 GGGGAGGCAGGGAGGCCCTGCGG - Intronic
1160926269 19:1547731-1547753 GAGGGGGGACAGAGGTCCTGAGG - Intergenic
1160955837 19:1691379-1691401 GAGAAGGAAAAGAGTCCCTCAGG - Intergenic
1161010697 19:1958263-1958285 AAGGACGAAGCGAGGCCCAGCGG - Intronic
1161020983 19:2011419-2011441 GAGGAGTGAGGGAGGCCCTGTGG - Intronic
1161115232 19:2493050-2493072 GAGATGGGAGTGAGGCCCTGGGG + Intergenic
1161115826 19:2495887-2495909 GAGGAGGAGGAGAGGCAGGGCGG - Intergenic
1161393970 19:4035017-4035039 GAGGAGGAAGAGAAGCTGTGGGG + Intronic
1161566213 19:5004321-5004343 GAGGAGGGAGCGAGGGCCTGTGG - Intronic
1161638088 19:5401862-5401884 AAGGAGGAAGAGAGGCAGGGAGG + Intergenic
1161968186 19:7560780-7560802 GTGGAGTCAGAGTGGCCCTGGGG - Intronic
1162044693 19:7990810-7990832 GAGGAGGAAGAGGGGCCATTGGG + Intronic
1162082205 19:8224924-8224946 GAGGAGGAAAGAAGGCTCTGTGG + Intronic
1162137503 19:8564714-8564736 GAAGAGGGAGAGAGGCTGTGGGG + Intronic
1162151214 19:8646903-8646925 CAGGAAGAACACAGGCCCTGAGG + Intergenic
1162190985 19:8946630-8946652 GAGGAGGAAGGGATACTCTGCGG + Exonic
1162246850 19:9408159-9408181 GAAGAGACAGAGAGGGCCTGTGG - Intergenic
1162727575 19:12699329-12699351 GAGGAGGGAAAGAGGGACTGTGG + Exonic
1162800175 19:13105671-13105693 GTGGAGGCGGACAGGCCCTGTGG - Intronic
1163126066 19:15244776-15244798 GAGAAGGTAGTGAGGCTCTGGGG + Intronic
1163530202 19:17844284-17844306 AAGGAGAAAGATAGGCGCTGGGG + Exonic
1163772263 19:19198249-19198271 CAGGAGGCTGAGAGGTCCTGGGG - Intronic
1163904777 19:20142920-20142942 GAGGAGAAAAACAGGCACTGAGG + Intergenic
1164442541 19:28290227-28290249 GAGGAGGAAGGCAAGCCCTGGGG + Intergenic
1164591707 19:29511114-29511136 GGGGAGGGAAAGAAGCCCTGGGG + Intergenic
1164647366 19:29869311-29869333 AAGGATTAAGAGAGGCCCTTAGG + Intergenic
1164818395 19:31224959-31224981 CAGGGGGAACAGGGGCCCTGGGG - Intergenic
1164826421 19:31287871-31287893 CAGGAGGAAAGGAGGCCCGGAGG - Intronic
1164902288 19:31938478-31938500 AGGGAGGAAGAGAGGGACTGAGG - Intergenic
1165111464 19:33504890-33504912 GTGGAGGACGAGAGCCCCTTTGG - Intronic
1165329873 19:35135430-35135452 GGGTGGGAGGAGAGGCCCTGGGG + Intronic
1165334804 19:35162245-35162267 GAGGAGGAAGAGAGGCCCTGGGG - Intronic
1165397824 19:35576817-35576839 GAGGGGGAAGAAAATCCCTGGGG + Intergenic
1165490445 19:36120307-36120329 GAACAGGAAGAGATGCTCTGGGG + Intronic
1165727400 19:38122767-38122789 GAGGTGGTACAAAGGCCCTGAGG - Intronic
1165765195 19:38346212-38346234 CAGGAGAAACAGAGGCCCTGAGG + Intronic
1165832750 19:38737304-38737326 GAGGATGAGGAAGGGCCCTGGGG - Exonic
1166200372 19:41233718-41233740 GAGGAGGATGGGAGGAACTGAGG - Intronic
1166691809 19:44826201-44826223 GAGAAGGAAGAGAGGCAGGGAGG + Intergenic
1166695782 19:44850937-44850959 GCGGGGGAAGCCAGGCCCTGGGG + Intronic
1166766744 19:45255774-45255796 GGGGAGGAAGAAAGGCCAAGAGG - Intronic
1166822513 19:45589176-45589198 GAGGAGGTAGAGAGGACGAGAGG - Intronic
1167123338 19:47532080-47532102 GAGGGGGAAGAAGGGCCCTTAGG + Intronic
1167146088 19:47681322-47681344 TGGGAGGAAGAGGGGTCCTGGGG + Intronic
1167335570 19:48883647-48883669 GAGGAGGAAGAGGAGGCCAGTGG - Intronic
1167600423 19:50451522-50451544 GAGGAGGGACTGAGGTCCTGAGG + Intronic
1167665466 19:50820915-50820937 GAAAAGGGAGGGAGGCCCTGGGG + Intronic
1167694016 19:51003439-51003461 GAGGAGGAGGTTAGGTCCTGCGG - Intronic
1168282640 19:55313614-55313636 AAGGATGAAGAGAGGGCCGGGGG - Intronic
1168651537 19:58095559-58095581 GAGCAGGAGGAGAGGGGCTGGGG - Intronic
925039163 2:716813-716835 GAGGAGGAGGGGAGGCCTTGGGG + Intergenic
925744070 2:7029918-7029940 GGTGATGAAGGGAGGCCCTGGGG + Intronic
925892722 2:8448876-8448898 GTGAAGTCAGAGAGGCCCTGGGG - Intergenic
926114650 2:10204773-10204795 GAAGAGGAAAAGGGACCCTGAGG - Intronic
927727382 2:25436901-25436923 GATGATGAAAAGAAGCCCTGTGG + Intronic
927943500 2:27120519-27120541 GAGGAGGAAGCCAGGCACAGTGG + Intergenic
928160805 2:28922530-28922552 ATGGAGGAAGAGAGGCGATGAGG + Intronic
928613668 2:33015839-33015861 GAGGAGGAAGAGAGAGAGTGGGG + Intronic
929406623 2:41649916-41649938 AAGGAGGAAGAGAGGGAGTGAGG + Intergenic
929460568 2:42099923-42099945 GAGGAGCAAGAGAGAGCATGGGG - Intergenic
929832317 2:45357050-45357072 GAGGAGGTAGAAAGGTCCAGAGG - Intergenic
929855244 2:45632110-45632132 GAGCAGGAAGAGGGCCCCTGCGG + Intergenic
929901328 2:46006076-46006098 TGGGATGAACAGAGGCCCTGGGG - Intronic
929910949 2:46089170-46089192 GAGGAGGGAGGAAGGCCCTGGGG - Intronic
929995823 2:46825760-46825782 GAGAAGGAAGGGCGGCCCAGAGG - Intronic
930035845 2:47084540-47084562 GAGGCGGAGGGGAGACCCTGAGG + Intronic
930107325 2:47650451-47650473 GAGGAAGAAGAGGGGACTTGGGG - Intergenic
930452593 2:51560792-51560814 GATGAGGAAAATAGACCCTGGGG + Intergenic
931192856 2:60022553-60022575 GAGGAGGAAGAGAGCTTCCGGGG + Intergenic
931476022 2:62588374-62588396 GAGGAGGAAGAGCGGGCAAGAGG + Intergenic
931799633 2:65746339-65746361 GAAGAGGAAGAGAGGAGGTGTGG + Intergenic
931859766 2:66342535-66342557 GAGGTGCAAGAGAGGCACTCAGG - Intergenic
932098392 2:68873104-68873126 GTGCAGCCAGAGAGGCCCTGCGG + Intergenic
932433422 2:71688852-71688874 GAGAAGGAAGAGAGGCCAGGTGG + Intergenic
932576239 2:72963819-72963841 GAGGAGGAAGCTAGGCCCAGGGG - Intronic
932798385 2:74717433-74717455 GAGCAAGAAGAGAGCTCCTGTGG + Intergenic
932901880 2:75710713-75710735 GCGGAGGAAGAGCCGCCCTCTGG - Exonic
933240267 2:79913275-79913297 GAGGAAGCAAAGAGGCCTTGAGG + Intronic
933707711 2:85304187-85304209 GCAGAGGAAGAGAGGCACTTGGG - Intronic
933773562 2:85758673-85758695 CAGGTGGGAGAGAGGCCCTCTGG + Intronic
933780222 2:85795958-85795980 GAGGAGGAAAGGGGGTCCTGAGG - Intergenic
933856140 2:86416272-86416294 GAGGAGGACTGGAGGCCCAGTGG + Intergenic
934062003 2:88303497-88303519 GAGGTGGAGCAAAGGCCCTGAGG - Intergenic
934516628 2:94992122-94992144 GAGGAGAATCAGAGACCCTGGGG + Intergenic
934751918 2:96799281-96799303 CAGGTGGGAGAGAGGGCCTGGGG - Intronic
935131646 2:100265226-100265248 GAGGAAGAAAAAGGGCCCTGGGG + Intergenic
935847067 2:107177385-107177407 GAGGAGAAGGAGAAGCCCAGAGG - Intergenic
936069548 2:109356545-109356567 AAGGAGGAGGAGGGGGCCTGTGG - Intronic
936944310 2:117916848-117916870 AAGGATCAAGAGAGGGCCTGGGG + Exonic
936969983 2:118168108-118168130 GAGGAGGAAGAGGGGACAAGGGG - Intergenic
937134540 2:119541628-119541650 AAGGAGACAGAGAGACCCTGGGG - Intergenic
937140626 2:119596805-119596827 GAGGTGAAAGAGAAGCCCTGAGG - Intronic
937322456 2:120969009-120969031 GAGGAGAAAGACAGGACCTGTGG + Intronic
937544570 2:123001396-123001418 GAAGATGAAGACATGCCCTGAGG + Intergenic
937765322 2:125654323-125654345 GAGGAGGAAGAGAAGCCCTATGG + Intergenic
937862556 2:126722468-126722490 GAGGAAGAAAGGAGACCCTGGGG - Intergenic
937929393 2:127192709-127192731 GAGGTCTAAGCGAGGCCCTGTGG - Intronic
938141652 2:128799449-128799471 AAGGAAGGAGAGGGGCCCTGGGG - Intergenic
938160393 2:128980181-128980203 GAGCAGGGTGGGAGGCCCTGTGG + Intergenic
939093820 2:137809618-137809640 GAGCAGGAAGAGAGGAAGTGGGG + Intergenic
939152534 2:138490070-138490092 GAGGAGGTAGAGAGAACATGTGG - Intergenic
939547065 2:143567185-143567207 GAGGAGGAAGGCAAGCACTGAGG - Intronic
940671596 2:156676257-156676279 TAGAAGGAAGAGTAGCCCTGGGG + Intergenic
941151095 2:161916613-161916635 GAGAGAGAAGAGAGGCACTGGGG - Intronic
941173577 2:162169584-162169606 GAGGAAGAAAAGAGGGGCTGTGG + Intergenic
942225453 2:173811089-173811111 GAGGAGGAAATGATGCCATGTGG - Intergenic
942509543 2:176682809-176682831 GAGGAGGAAGAGAGGGAGGGAGG + Intergenic
943691180 2:190871234-190871256 GAGGAGGAAGAGAGAGCAGGGGG + Intergenic
944661764 2:201927267-201927289 GATGAGGAACAGAGGCTCGGAGG - Intergenic
946037501 2:216755600-216755622 GTTGAGGAGGAGAGGCCGTGGGG + Intergenic
946281379 2:218668187-218668209 GAGGAAGGGGAGAGTCCCTGGGG - Intronic
946314662 2:218902605-218902627 GAGGAGGTGCAAAGGCCCTGAGG - Intergenic
946367665 2:219259626-219259648 GAAGAGGGAGAGAGACCCAGAGG - Intronic
946408616 2:219505689-219505711 GAAGCAGAAGAGAGGCCCTGGGG - Intronic
947133548 2:226954638-226954660 GAGGATGAAGAGATGCACAGAGG + Intronic
947630984 2:231652867-231652889 AGGGTGGAAGAGGGGCCCTGGGG - Intergenic
947796057 2:232894707-232894729 GGGGATGAAGAAGGGCCCTGAGG + Intronic
947826023 2:233106598-233106620 GAGGAGGAGGAGGGGTGCTGTGG - Intronic
948021600 2:234737986-234738008 GAGCAAGCAGAGAGGCCCTGGGG - Intergenic
948207509 2:236170004-236170026 GAGGAGGAGGAGAGGGCTGGCGG - Intergenic
948387814 2:237592567-237592589 GACGGTGCAGAGAGGCCCTGAGG + Intronic
948742008 2:240054337-240054359 CAGGAGCAAGAGAGGCAGTGAGG - Intergenic
948748215 2:240110816-240110838 GAGGAGGAAGAGAGGAGGAGGGG - Intergenic
948761086 2:240191425-240191447 GATGCGGGAGAGAGGCCCAGAGG + Intergenic
948799750 2:240427061-240427083 GTGGTGGAGGTGAGGCCCTGTGG - Intergenic
948805941 2:240453474-240453496 GAAGAGGAAGGGGGGCCCCGGGG - Intronic
948824596 2:240568241-240568263 GGGGAGGAAGCGAGGGGCTGGGG + Intronic
1168967161 20:1905639-1905661 GAGGAGGAGGAAAGGTCCTTAGG + Intronic
1169117900 20:3078000-3078022 CAGGAGGATGAGAGACCATGTGG + Intergenic
1169118915 20:3083816-3083838 CAGGAGGAAGAGAGGCTGCGGGG + Intronic
1170158723 20:13291536-13291558 GAGGAGGGAGTGAGGCACTGTGG - Intronic
1170625131 20:18024634-18024656 GAGGAGGAGGAGAGGAAGTGAGG - Exonic
1170638290 20:18128752-18128774 CAGGAGGAAGAGAGGAAGTGGGG + Intergenic
1171100537 20:22379625-22379647 CTGGAGGATGAGAGGCCCTGGGG - Intergenic
1171279011 20:23881040-23881062 GAGGAGCAAGAGAGGCTCTTGGG - Intergenic
1171319995 20:24234046-24234068 GGAGAGGAGGAGAGGCCCTAGGG + Intergenic
1171431643 20:25086558-25086580 GTGGAGGAAGAGGAGACCTGGGG - Intergenic
1171481359 20:25458108-25458130 GGGGAGCAGCAGAGGCCCTGGGG - Intronic
1171987553 20:31671054-31671076 GAGGATGCAGACAGGCCCTTGGG - Intronic
1172100991 20:32483810-32483832 AAGGAGGGAGAGAGGCGCGGGGG + Intronic
1172112604 20:32556137-32556159 GAAGAGCCAGAGAGGCTCTGCGG + Intronic
1172122339 20:32605877-32605899 GAGGGGGAGGGGAGACCCTGTGG - Intronic
1172125955 20:32625422-32625444 GTGGAGGGAGAGAGGCTCTGTGG + Intergenic
1172242187 20:33420566-33420588 AGGGAGGAAGACAGGACCTGTGG - Intronic
1172250771 20:33477639-33477661 GACGAGGGAGGGAAGCCCTGGGG + Intergenic
1172624409 20:36338975-36338997 GAGGAGGCTGAGAGGGGCTGGGG + Intronic
1173000608 20:39102679-39102701 CAGGAGGCAGCAAGGCCCTGAGG + Intergenic
1173071914 20:39776332-39776354 GAGGAGAGAGAGAAGACCTGAGG - Intergenic
1173249441 20:41356933-41356955 GAGGAGAATGAGAGGCCCGAGGG + Intronic
1173464030 20:43267268-43267290 TGGGAGGAAGAGGAGCCCTGAGG + Intergenic
1173516439 20:43667953-43667975 GGGGAGAGAGAGAGTCCCTGGGG + Intronic
1173563538 20:44023005-44023027 GGGGAGGAAGAGAAGGCCAGAGG + Intronic
1173596383 20:44261111-44261133 GAGGAGGCAGAGAGGATCTCAGG + Intronic
1173614053 20:44391186-44391208 GAGGAGGATGAGAGGCAGGGAGG - Intronic
1173647935 20:44645198-44645220 GAGGTGGAAGGGAGGACCAGCGG + Intronic
1173803203 20:45907850-45907872 GAGGAGGAAGCGCATCCCTGAGG + Exonic
1173957468 20:47045275-47045297 CTGGAGGAAGAGAGTCCATGTGG - Intronic
1174266682 20:49337004-49337026 GAGGAGCAAGAGAGGCCATTGGG + Intergenic
1174334498 20:49849313-49849335 GTGGAGGGAAAGGGGCCCTGGGG + Intronic
1174378785 20:50143281-50143303 CAAGAGGAAGAGAGGAACTGAGG + Intronic
1174482164 20:50838934-50838956 GTGGAGGTGCAGAGGCCCTGTGG + Intronic
1175291507 20:57879007-57879029 GAGGAGGAAGAGGACCCCAGGGG + Intergenic
1175496684 20:59419351-59419373 GAGGAGGGAGGCAGGGCCTGGGG + Intergenic
1175540278 20:59743801-59743823 CAGGAAGAAGAGAGGCCCAGAGG - Intronic
1175777583 20:61662970-61662992 GGGGAGGAGGAGAGGCCCTGAGG - Intronic
1175858105 20:62133570-62133592 CAGGAAGAAGAGAGGCCCAGAGG + Intronic
1175892293 20:62321202-62321224 GTGGAGGAAGAGGGGGCCAGTGG + Intronic
1175892414 20:62321543-62321565 GTGGAGGAAGAGGGGGCCAGTGG + Intronic
1175933357 20:62503746-62503768 GGGGAGGCAGGGAGGCCCTGAGG + Intergenic
1175986205 20:62765275-62765297 GAGAGGGAAGAGAGGCTCGGAGG - Intergenic
1176213038 20:63934531-63934553 GAGGCGTAGGAGCGGCCCTGCGG + Exonic
1176937117 21:14880280-14880302 GTGTAGGAAGAGAAGCACTGAGG - Intergenic
1176963611 21:15187636-15187658 CAGGAGGAAGAGAGGGAGTGGGG + Intergenic
1177215360 21:18121108-18121130 TAGAAAGAAGAGAAGCCCTGAGG - Intronic
1177614622 21:23500790-23500812 CAGGAGGAAGAGAGGTCTGGGGG - Intergenic
1177620858 21:23591191-23591213 GTGTAGGAAGAGGGGCCCAGTGG + Intergenic
1177828258 21:26107890-26107912 GAGGAGGAAGAGAGCACCACAGG + Intronic
1177960090 21:27653430-27653452 GAGAAGGAAGAGAAGCCAGGAGG + Intergenic
1178481610 21:32984128-32984150 GTGTTGGAAGTGAGGCCCTGGGG - Intergenic
1178759793 21:35391443-35391465 GAGGAGGAAGACAGCCCTTCTGG + Intronic
1179630454 21:42674642-42674664 GAGGCAGCAGAGAGGACCTGGGG - Intronic
1179632366 21:42686431-42686453 GTGGAGGCAGAGAGGCCCGGAGG - Intronic
1179852700 21:44146564-44146586 CAGGAGGCTGAGAGGCTCTGGGG - Intergenic
1179939046 21:44626615-44626637 CAGGAGGCACAGAGGCCATGGGG + Intronic
1180120729 21:45745804-45745826 GAGGAGTGAGTGAGGACCTGGGG + Intronic
1180127568 21:45802682-45802704 CATGGGGAGGAGAGGCCCTGAGG + Intronic
1180160712 21:45997675-45997697 GAGGAGGAAGAGGAGGCGTGAGG - Intronic
1180230956 21:46426570-46426592 TGGCAGGAGGAGAGGCCCTGGGG - Intronic
1181581271 22:23829375-23829397 GAGAAGGAAGGTGGGCCCTGTGG + Intronic
1181821474 22:25479056-25479078 GAGAAGGAATTAAGGCCCTGTGG + Intergenic
1182087494 22:27571416-27571438 GATGTGGAAGATAGACCCTGTGG - Intergenic
1182102294 22:27666666-27666688 GGGGAGGAGGAGAGACCATGTGG - Intergenic
1182326406 22:29516618-29516640 GAAGAGGGAGCGAGGCCCTGTGG + Intronic
1182334629 22:29575564-29575586 GAGCAGGAAGAGAGGGCTTGGGG - Intronic
1182354240 22:29715199-29715221 GAGGAGGGGGACAGGCCCTGGGG + Intergenic
1182409053 22:30166783-30166805 AAGGAGCAAGAGAGGCTTTGTGG + Intronic
1182446520 22:30392825-30392847 GAGGAGGAAGTGGGGCTCGGGGG + Intronic
1182465652 22:30514619-30514641 GAGGTGGAAATGAGGCTCTGGGG + Intergenic
1182588409 22:31360338-31360360 GGTGAAGAAGAAAGGCCCTGGGG + Intergenic
1182647328 22:31820860-31820882 AAGAAGGAAGAGAGCCTCTGAGG - Intronic
1182779152 22:32853578-32853600 GAAGAAGAAGAGGGGCCCAGAGG + Intronic
1182805476 22:33066383-33066405 GAGGAGGAACAGAGACCCAGAGG - Intergenic
1182871194 22:33649183-33649205 GAGGACAAGGAGAGCCCCTGAGG - Intronic
1183418671 22:37697492-37697514 GGGGAGGATCAGAGACCCTGGGG + Intronic
1183489387 22:38108560-38108582 CAGGGGGATGGGAGGCCCTGAGG + Intronic
1183502092 22:38186678-38186700 GAGCAAGAACAAAGGCCCTGAGG + Intronic
1183587126 22:38759321-38759343 CAGGAGTAGGAGAGGCCTTGGGG - Intronic
1183978534 22:41526787-41526809 GAGCAGGCAGAGAGGGTCTGAGG + Exonic
1184133291 22:42530671-42530693 GAGGAGGAAAGGAGACCCTTGGG + Intergenic
1184259901 22:43308749-43308771 GAGGAGTAGGAGGGGCCCTCGGG - Intronic
1184380760 22:44143653-44143675 CAGGAGGCAGCGAGGACCTGTGG - Intronic
1184404068 22:44290138-44290160 GTGGAGGAGGAGAGTTCCTGAGG + Intronic
1184414815 22:44346135-44346157 CAGGATGATGAGAGGTCCTGAGG + Intergenic
1184529893 22:45048744-45048766 GAGCAGGGAGAGAGGCCACGAGG - Intergenic
1184556384 22:45235476-45235498 GGGGAGGAAGTGTGGCCGTGTGG - Intronic
1184950568 22:47839772-47839794 GAGGGGGAGGAGCGGCCATGCGG - Intergenic
1185085901 22:48740931-48740953 GAGGAGGCAGATGGGACCTGCGG - Intronic
1185164346 22:49251558-49251580 GAGGAGGAGGAGCGGCTGTGAGG + Intergenic
1185210068 22:49565701-49565723 GAGGAGGAAGGGAGGGCCTTGGG - Intronic
1185267742 22:49913341-49913363 GAGGAGGGAGTGAGGGACTGTGG - Intronic
1185278026 22:49958071-49958093 GCAGAGGGTGAGAGGCCCTGAGG + Intergenic
949943494 3:9172568-9172590 GAGGAGGCAGACAGGAGCTGGGG - Intronic
950472759 3:13196840-13196862 GACAAGGAATAGAGCCCCTGCGG - Intergenic
950628780 3:14267566-14267588 GAAGAGGCAGAGAGGCTTTGGGG - Intergenic
950905307 3:16532120-16532142 GAGAAGGGAGAGAGGCTATGGGG + Intergenic
952786769 3:37163447-37163469 GAGGACAAAGAGAGGGACTGTGG - Intronic
952967530 3:38630527-38630549 GAGGAGGAGGAGAGGGGCTGAGG + Intronic
953413346 3:42702200-42702222 GTGGGGGTGGAGAGGCCCTGGGG + Intronic
953606522 3:44416436-44416458 GGGTAGGAATAGGGGCCCTGCGG + Intergenic
953718433 3:45335336-45335358 GAGCAGGAGCAAAGGCCCTGAGG + Intergenic
953877376 3:46674013-46674035 AGGGTGGAAGGGAGGCCCTGGGG + Intronic
953927664 3:46990591-46990613 GAGGAGGAAGAGTAGGGCTGGGG - Intronic
954372311 3:50175272-50175294 GAGGTAGAGGGGAGGCCCTGGGG - Intronic
954442181 3:50527878-50527900 GAGGAGGTTCAGAGGCTCTGGGG - Intergenic
954632986 3:52056852-52056874 CTGCGGGAAGAGAGGCCCTGGGG + Intergenic
954955794 3:54517470-54517492 GGGGTGGACAAGAGGCCCTGGGG - Intronic
955892839 3:63668367-63668389 AAGAAGGAAGAGAGGAACTGGGG + Intronic
956521694 3:70110988-70111010 AATGAGGAAGAGAGGCCCCCAGG - Intergenic
956762422 3:72455763-72455785 GAACAGGCAGAAAGGCCCTGAGG - Intergenic
958501203 3:94911290-94911312 GAGAAGGAGGAGATGACCTGAGG + Intergenic
958826394 3:99035862-99035884 TTGGAGGAGGAGAGGCGCTGCGG - Intergenic
958828756 3:99063724-99063746 TTGGAGGAGGAGAGGCGCTGTGG + Intergenic
959803795 3:110527085-110527107 GTGGAGGAAGAAAGGCAATGGGG + Intergenic
960446583 3:117756871-117756893 GAGAATGAAGAGTGTCCCTGTGG - Intergenic
960582491 3:119292984-119293006 AAGGGGGAAGACAGGCCGTGGGG + Intergenic
960583079 3:119296818-119296840 GAGGGGGAAAAGAAGCCCAGAGG + Intronic
961011685 3:123440615-123440637 GAGGAGCAAGACAGGCGATGGGG - Intronic
961333462 3:126156483-126156505 CAGGAGGGAAGGAGGCCCTGGGG - Intronic
961396336 3:126594151-126594173 GAGGAGATAGAGAGGCACAGAGG + Intronic
961491357 3:127258558-127258580 GAGGTGGACAAGAGGCCCTCGGG - Intergenic
961546701 3:127639289-127639311 GAGGTGGAGGTGAGGCCCTCTGG - Exonic
962362522 3:134754221-134754243 GACAAGGAAGAGAGTCCCTGAGG - Intronic
962528717 3:136258770-136258792 AAGGTGAAGGAGAGGCCCTGTGG + Intronic
962743239 3:138378489-138378511 GGGGAGGAAGAGAGGCTCCGAGG - Intronic
962841674 3:139238396-139238418 GAGGAGGAAGAAGGGCAATGTGG - Intronic
962919266 3:139935982-139936004 GGGGAGTCAGAGACGCCCTGGGG - Intronic
963849674 3:150198431-150198453 GAGTAGGAGGGGAGCCCCTGGGG + Intergenic
963987772 3:151617155-151617177 GAGGAGGAAGAGAGGGGAGGGGG - Intergenic
964282384 3:155080239-155080261 GGGGAGGGAGAGGGGCCCAGAGG + Intronic
964831341 3:160886790-160886812 TTGGAGGAAAAGAGGCCCTCTGG - Intronic
966737163 3:183196099-183196121 GAGGAGGGAGGCAGGCACTGAGG - Intronic
967536891 3:190615039-190615061 GAGGAGAAAGAGAAGGCATGTGG - Intronic
968000803 3:195204996-195205018 GTGGAGGGAGAGAGGACCTCTGG + Intronic
968056809 3:195697978-195698000 GAGGAGGAAGGGAGGAGCAGAGG - Intergenic
968461082 4:725406-725428 GAGGAGGGGCAGCGGCCCTGAGG + Intronic
968473663 4:792866-792888 GGGGAGGGAGAGTGGCGCTGTGG + Intronic
968480510 4:831049-831071 GTGGCGGAAGTGAGTCCCTGGGG + Intergenic
968594196 4:1473942-1473964 AGGGAAGATGAGAGGCCCTGGGG + Intergenic
968698256 4:2042885-2042907 GATGAGGAAGAGGCCCCCTGCGG + Intronic
968699175 4:2046755-2046777 GAGCAGGAAGGGAGGGGCTGCGG - Intergenic
968891574 4:3372177-3372199 CTGGAGGAAGAGAGCCCTTGTGG + Intronic
968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG + Intergenic
969303381 4:6310463-6310485 GAGGAAGAACAGAGGCACTGGGG + Intergenic
969315597 4:6379921-6379943 GGGGGTGAAGAGAGGACCTGCGG - Intronic
969568242 4:7992761-7992783 CAGCAGGAGGAGAGGCCCCGGGG - Intronic
970491862 4:16583064-16583086 GAGGAGCAGGCGAGACCCTGAGG - Intronic
971260773 4:25054724-25054746 CAGAAGGCAGAAAGGCCCTGGGG + Intergenic
972103716 4:35455596-35455618 GATGAGAAAGAGAGACACTGAGG - Intergenic
972233280 4:37099861-37099883 GTGGAGGAAGGGGGGCCATGAGG + Intergenic
972387642 4:38583268-38583290 GTGGAGGAAGAGAGATCCTGTGG + Intergenic
973015053 4:45127675-45127697 CAGGAGGAAGAGAGAGCATGGGG - Intergenic
973686750 4:53377899-53377921 GAGGAGGAAGAGTGGCTCTATGG + Exonic
973850186 4:54954403-54954425 GAGGAGGAAGAGGGGCTCTGAGG + Intergenic
976356399 4:84122671-84122693 CCGCAGGAGGAGAGGCCCTGAGG - Intergenic
977546458 4:98387577-98387599 GAAGAGGAAGAAAGGCACTGAGG - Intronic
977744561 4:100530292-100530314 TTGGAGGAAAAGAGGCTCTGTGG + Intronic
978237059 4:106472347-106472369 CAGGAGGCAGAGAAGCCCAGAGG - Intergenic
978352815 4:107838087-107838109 TTGTAGGCAGAGAGGCCCTGAGG + Intronic
978747960 4:112215755-112215777 GAAATGGAAGAGAGGCCATGTGG - Intergenic
979639117 4:122991370-122991392 CTGGAGGATGAGAGACCCTGTGG + Intronic
980103075 4:128561333-128561355 GAGAAGGAAGAGAGAACCAGGGG - Intergenic
980156484 4:129114151-129114173 GAGGAAGCAGAGAAGCCCTAGGG - Exonic
981637473 4:146897493-146897515 GACCAAGGAGAGAGGCCCTGTGG - Intronic
982774066 4:159424318-159424340 GAGGAGGAAGAGAGGTATAGTGG + Intergenic
984560108 4:181258132-181258154 CTGGAGGAAGAGAGACCATGTGG - Intergenic
984702832 4:182829077-182829099 GAGGAGGAAGGAAAGCCCTCGGG + Intergenic
985828716 5:2212729-2212751 GAGGAGGCAGAGAGGCCAGAGGG + Intergenic
986820181 5:11458246-11458268 TAAGAGGAAGACAGGCCCAGGGG + Intronic
987946949 5:24622358-24622380 GAGGGAGAAGAAAGGGCCTGAGG + Intronic
988011835 5:25498557-25498579 GAAGTGGAAGAGAGGCCCAGAGG - Intergenic
988662806 5:33291764-33291786 GTGGAGGCTGAGAGGCCATGTGG + Intergenic
990952771 5:61314193-61314215 GTGGAGGAATAGGGGCACTGGGG - Intergenic
991017320 5:61945963-61945985 GGGGAGGAAGAGAGGGGCTGGGG + Intergenic
991540853 5:67726585-67726607 AAGGAGAAAGAGAGGTCATGAGG + Intergenic
991960668 5:72040759-72040781 AAGGACAAAGGGAGGCCCTGGGG + Intergenic
992640541 5:78765107-78765129 AAGGTGGAAGAGAGGCCCTCAGG - Intronic
994014159 5:94945865-94945887 GAGGAAGTGGAGAGGCACTGAGG + Intronic
994072965 5:95621419-95621441 GAGGACGAGGAGGGGCCCCGGGG + Exonic
994691982 5:103030974-103030996 GAGGGGGAAGACAGGATCTGAGG + Intronic
995037048 5:107546015-107546037 GAAGAGGAAGAGTGGACCTTTGG + Intronic
995557357 5:113343475-113343497 GAGCCAGAACAGAGGCCCTGAGG - Intronic
996558350 5:124801776-124801798 GGAAAGGAAGAAAGGCCCTGTGG - Intergenic
997187886 5:131900585-131900607 GAGGAGGAAGGCAAGCCTTGGGG - Intronic
997205516 5:132046848-132046870 TGGGAGGAAGAAAGGCCCAGTGG - Intergenic
997263916 5:132483923-132483945 GAGGAATAAGAGGGGCCCAGGGG + Exonic
997875903 5:137546556-137546578 GAAGAGGAAGAAAAGCCTTGGGG - Intronic
998167009 5:139849841-139849863 GTGAAGGAGGAGAGACCCTGGGG - Intronic
998370313 5:141656490-141656512 GAGAAGAAAGTGAGGCCCTGGGG - Exonic
998533918 5:142911377-142911399 GAGCAGGTGGACAGGCCCTGGGG - Intronic
998592168 5:143489333-143489355 GAGGCAGAAGAGAGGCCCTAAGG - Intergenic
998604055 5:143615537-143615559 GAGGAGGAAGAGAGGAGGAGAGG - Intergenic
998617042 5:143752019-143752041 AAGAAGGGAGACAGGCCCTGGGG + Intergenic
999154749 5:149450307-149450329 GAGGAGGTGGAGAGGCCCGCAGG + Intergenic
999247692 5:150163924-150163946 CAGTATGAACAGAGGCCCTGAGG - Intergenic
999266178 5:150268352-150268374 CAGCAGGTACAGAGGCCCTGAGG - Intronic
1000459549 5:161497775-161497797 AAGGAGACAGAGAGGCCTTGGGG + Intronic
1000732832 5:164857378-164857400 GAGGAAGAACAGAGGATCTGAGG - Intergenic
1001100956 5:168813959-168813981 CAGGAGGAAAAGAGGCATTGGGG - Intronic
1001436550 5:171703772-171703794 GCAGAGGAAAAGAGGCCATGAGG - Intergenic
1001482768 5:172099955-172099977 GAGGAGGAAGGAGGGCCATGGGG + Intronic
1001566276 5:172701456-172701478 GATGAGGAAGACAGGACTTGGGG + Intergenic
1001604091 5:172947700-172947722 GAGGGGAAACTGAGGCCCTGGGG - Intronic
1001702896 5:173720616-173720638 AAGGAGGAAGGGAGGCACAGAGG - Intergenic
1001770563 5:174293020-174293042 GCAGAGGGAGAGGGGCCCTGTGG + Intergenic
1002049522 5:176562252-176562274 CTGGAGGAAGGGAGGCCTTGAGG + Intronic
1002050170 5:176566033-176566055 GAGGAGGAAGCGTGGCCCAAGGG - Intronic
1002092198 5:176812112-176812134 GATTAGAAGGAGAGGCCCTGGGG - Intronic
1002105959 5:176879557-176879579 GAGGTGGACAGGAGGCCCTGTGG + Intronic
1002317034 5:178350019-178350041 GAGGGGGCACAGAGGGCCTGAGG - Intronic
1002591414 5:180293323-180293345 AAGCAGGAAGAGAGGCACTGAGG + Intergenic
1002615692 5:180454313-180454335 GAGGCAAAGGAGAGGCCCTGGGG + Intergenic
1002782552 6:378800-378822 GCACAGGAAGAGAGGCACTGTGG + Intergenic
1002782817 6:380050-380072 GAGGCGCAAGAGAGCCCCAGTGG - Intergenic
1003121926 6:3325134-3325156 GAGGAAGAAGACAGACCCTTCGG + Intronic
1003192655 6:3888125-3888147 AAGGAGGGAGAGAAGTCCTGGGG + Intergenic
1003282632 6:4707189-4707211 GATGAGGAAATAAGGCCCTGAGG + Intronic
1003509973 6:6771479-6771501 GAGGAGGAGGAGAGACCATTTGG + Intergenic
1004015118 6:11725154-11725176 GTGAAGCAAGAGAGGCCCTAGGG + Intronic
1004176402 6:13343990-13344012 TAGGAGGAAGAGAGGGAGTGGGG - Intergenic
1004661008 6:17709162-17709184 TAGGAGGAAGATAGCACCTGAGG - Intergenic
1005332670 6:24764864-24764886 GAGGCGAAAGGGAGGCCCAGTGG - Intergenic
1006148379 6:31972462-31972484 GCGGCGGAAGCGAGGGCCTGTGG + Exonic
1006301756 6:33197335-33197357 AAGAAGGAAGGGAAGCCCTGAGG + Intronic
1006338301 6:33432180-33432202 GAGGAGGAAGAGTGTCCCAGGGG + Exonic
1006408866 6:33860485-33860507 GAGGAGGAAGGAAGGGCATGAGG + Intergenic
1006932852 6:37697929-37697951 GAGGAGGAAGAGAGGGAGGGAGG - Exonic
1007241463 6:40429251-40429273 GAGGAGGAGGACAGGGCTTGGGG - Intronic
1007393786 6:41565719-41565741 GAGGAGGAAGAGAGACACAGGGG - Intronic
1007548049 6:42708984-42709006 GAGGAGCAAGTGGGGCCCAGAGG + Intronic
1007620069 6:43206566-43206588 GAGGAAGAGGAGAGGACCTTTGG + Intronic
1007844230 6:44740498-44740520 GAGGAGAGGGAGAGGGCCTGGGG + Intergenic
1008778394 6:55069737-55069759 GAGCAGGAACAAAGGCCCTGAGG + Intergenic
1009892981 6:69711323-69711345 GGGGAGCAAGAGAGGGCATGAGG + Intronic
1010643708 6:78361779-78361801 TAGGAGCAAGTGAGGCACTGAGG - Intergenic
1010688324 6:78877873-78877895 TAGCAGCAAGAGAGGCTCTGTGG - Intronic
1011243690 6:85299529-85299551 AAGGGATAAGAGAGGCCCTGTGG + Intergenic
1011347261 6:86384747-86384769 GATGAGAGAGAGAGGCCATGAGG + Intergenic
1011786120 6:90847063-90847085 TAGGATGAATAGAGGACCTGTGG - Intergenic
1012751559 6:103169588-103169610 GAGGAGGAAGAATGGCCTTTTGG - Intergenic
1013173025 6:107654673-107654695 GAGGAAGAATCGAGGCTCTGAGG + Intronic
1013173074 6:107654887-107654909 GAAGAGGAATTGAGGCTCTGAGG + Intronic
1013194422 6:107832768-107832790 CAGGAAGAAGAGAGGCCGTAGGG + Intergenic
1013291156 6:108719773-108719795 AGGGAGGAAGTGAGGTCCTGGGG - Intergenic
1013717914 6:112985560-112985582 GAGGAGGAAGAAAATCCCTGGGG - Intergenic
1014172891 6:118298499-118298521 GGGGAGGTAGAGAGTCACTGGGG - Intronic
1014937433 6:127400629-127400651 CAGGAGGAAGAGAGACAGTGGGG + Intergenic
1015416858 6:132959026-132959048 GAGGATGAAGAGAGGGCATTTGG + Intergenic
1016370239 6:143366157-143366179 AAGAAGGAGGAGAGTCCCTGAGG - Intergenic
1017036804 6:150274349-150274371 GAGGAGGAGGAGAAGCGCTGGGG - Intergenic
1017040792 6:150307223-150307245 GAGGAGGAAAAGATTCACTGTGG - Intergenic
1017201937 6:151763966-151763988 GAAGGGGAAGGGCGGCCCTGTGG + Intronic
1017229420 6:152056537-152056559 GTGGAGGAAGAGATGCCTTAGGG + Intronic
1017558949 6:155606347-155606369 GAGCAAGAGCAGAGGCCCTGAGG + Intergenic
1017809516 6:157974805-157974827 GAGGAGGAAGAGGAACCCCGGGG - Intergenic
1018103090 6:160458507-160458529 GAAGAGGCAGACAGGCCCCGTGG - Intergenic
1018421014 6:163641099-163641121 AAAGAGGAAGAGAGGCCCTCAGG + Intergenic
1018685096 6:166298094-166298116 GAGAAGGAGGACAGGCGCTGAGG - Intergenic
1018705666 6:166461782-166461804 GAGGAGCTAGAGGGGCCATGTGG - Intronic
1018839649 6:167508405-167508427 GATGAGGAAGAGAGGGGATGGGG - Intergenic
1019113410 6:169737380-169737402 GTGGAGGAAAAGAGGCACTCTGG + Intergenic
1019394578 7:810626-810648 CAGGAGCAAGAGAGGCCGTGAGG + Intergenic
1019502293 7:1370259-1370281 GTGTGGGCAGAGAGGCCCTGGGG + Intergenic
1019886316 7:3909027-3909049 GATGAGGAAGACAGCCCCTCTGG + Intronic
1021838792 7:24705940-24705962 GAGGAGGGAGAAGGGCCCTCCGG + Intronic
1021873690 7:25028963-25028985 CAGGTGGAAGAAAGGCCTTGGGG + Intergenic
1021937415 7:25644923-25644945 GAGTAGGACGAGAGGCTCAGTGG + Intergenic
1022505597 7:30907222-30907244 GAGGAACTTGAGAGGCCCTGGGG + Intergenic
1022531623 7:31070351-31070373 GAGGAGGAAGAGGAGGCCTGTGG + Intronic
1022975364 7:35551037-35551059 GGGGAGGCAGAGCGGCCGTGTGG + Intergenic
1023117758 7:36878970-36878992 GAGGATGGGGAGAGGCCCTTCGG - Intronic
1023393311 7:39730876-39730898 GATGAGGAAAAGAGGCCCAGAGG + Intergenic
1023595613 7:41826705-41826727 AAGGGGAAAGAGAGTCCCTGAGG + Intergenic
1023882078 7:44326282-44326304 GAGGGGGAAGGGAGGGGCTGGGG - Intronic
1023962406 7:44937839-44937861 CAGGTGGATGAGAGACCCTGAGG + Intergenic
1024909252 7:54426607-54426629 GAAAAGAAAGAGAGGCCCTGCGG + Intergenic
1024942612 7:54777947-54777969 AGGGAGGAAGTGAGTCCCTGGGG + Intergenic
1024973500 7:55092168-55092190 GGGGAGGAAAACAGGCTCTGCGG + Intronic
1025777110 7:64569461-64569483 GAGGAGGGCCAGGGGCCCTGGGG + Intergenic
1026479291 7:70764463-70764485 CAGGAGCGAGAGAGGCCCTGAGG + Intronic
1026893570 7:73997279-73997301 GATGAGGAAGAGAGGGCTTCAGG + Intergenic
1027226137 7:76244698-76244720 GAGCAGGGAGAGAGGTCTTGAGG - Intronic
1027234706 7:76291420-76291442 GTGGAGGCAGAGAGGGCATGAGG - Intergenic
1027424415 7:78047874-78047896 TAGGAGGCAGAGAGGCAGTGGGG - Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028596104 7:92547389-92547411 CAGGAGGCAGACAGGCTCTGGGG + Intergenic
1029514666 7:101017814-101017836 GGGGAGGAAGGGAGTCCCAGGGG - Intronic
1029539990 7:101177135-101177157 GAGGAGGAAGCCAGGCTCAGAGG + Intronic
1029598448 7:101549978-101550000 GAGCAGGTACAAAGGCCCTGAGG + Intronic
1030051159 7:105538842-105538864 GAGGTGGCAGAGAGAACCTGGGG - Intronic
1030209202 7:106979859-106979881 GAGGGGAGGGAGAGGCCCTGAGG - Intergenic
1030465932 7:109903849-109903871 GAGAAGGAAGTGTGGCCTTGTGG - Intergenic
1030850567 7:114480254-114480276 GAGGAGGAAGAGGGGGACAGGGG - Intronic
1030974529 7:116105194-116105216 GAGGAGAAAGAGAGACCAGGAGG + Intronic
1031071736 7:117169538-117169560 GAGGATGAAGAGAGGCCCAAAGG - Intronic
1031100930 7:117479495-117479517 GAGGAGGAAGGCAGGCTCCGGGG + Intronic
1031999093 7:128253172-128253194 GAGATGGGATAGAGGCCCTGAGG - Intronic
1032455206 7:132067960-132067982 GAGGAGGGAGAGAGGACGAGGGG - Intergenic
1032695538 7:134332908-134332930 GAGGAGGAGGAGAGGCGGGGAGG - Intergenic
1033557375 7:142500399-142500421 GAGGAGGAAGAGAGACAGAGAGG + Intergenic
1033573222 7:142654938-142654960 GATGAACAAGAGAGGCCATGAGG + Intergenic
1034377557 7:150659407-150659429 GAGGAGGGAGCCTGGCCCTGAGG - Intergenic
1034456815 7:151175063-151175085 GAGAGGGAGGAGAGTCCCTGAGG - Intergenic
1034475665 7:151280136-151280158 GAGGAGAAAGGGAGGCTATGGGG - Intergenic
1034876275 7:154727290-154727312 GAGGAGGAAGAGAGCACAGGGGG + Intronic
1034969680 7:155411210-155411232 GAGGAGGCAGGGAGCCCCAGGGG - Intergenic
1035085910 7:156257759-156257781 CAGGAGGAAGAGAGGGACGGGGG + Intergenic
1035388960 7:158492277-158492299 GTGGAGGAACAGAGACCTTGGGG + Intronic
1035680347 8:1483176-1483198 GTGGCTGATGAGAGGCCCTGAGG + Intergenic
1035781259 8:2229753-2229775 GAGGAGGAAGGGATGCCCGGAGG - Intergenic
1036036918 8:5029795-5029817 CAGGAGGAAGAGAGAGCCAGGGG - Intergenic
1036964614 8:13282364-13282386 GAGGATGTAGAGATGCCCTCAGG + Intronic
1037508096 8:19552900-19552922 GTGGCTGATGAGAGGCCCTGGGG + Intronic
1037773953 8:21820437-21820459 GAGGAAGAAGAGATGCAATGGGG + Intergenic
1037992595 8:23331320-23331342 GAGGAGGGAGAAGGGCTCTGGGG - Intronic
1037994990 8:23345500-23345522 GAGGAGGCAGGGAAGCCCTCTGG + Intronic
1039167992 8:34708007-34708029 CAGGAGCAAGAGAGAACCTGAGG + Intergenic
1039357860 8:36841143-36841165 GAGGAGCCAGAGAGCCCCAGAGG - Intronic
1039437127 8:37567342-37567364 TTGGAGGGAGGGAGGCCCTGGGG - Intergenic
1040576151 8:48653035-48653057 GAGGAGGGAGGGAGGCCATGTGG + Intergenic
1040624110 8:49125753-49125775 GAACAGGAAGAGAGGCCATTTGG - Intergenic
1041031446 8:53739906-53739928 GAGGAGGAATAGAGTTGCTGGGG - Intronic
1041067289 8:54094274-54094296 GAGGAGGAGGAAAGGCCTGGTGG - Intronic
1041177080 8:55207873-55207895 GAGGAAGAAGAGAGGGCCTGGGG - Intronic
1041864233 8:62550937-62550959 GAGGAGGAAGAGAGTGGCAGAGG - Intronic
1041952450 8:63518711-63518733 CTGGAGGAAGAGAGGCCACGTGG + Intergenic
1042027455 8:64439143-64439165 GAGGGGGAAAGGAGGCACTGAGG + Intergenic
1042211309 8:66383330-66383352 GACGTGGGAGAGAGGCCTTGGGG + Intergenic
1042537553 8:69873859-69873881 GAGGAGGAAGAGAGGAGACGGGG + Intergenic
1042946934 8:74164570-74164592 GGGGAGGAGTAGAGGCCCTAAGG + Intergenic
1043553546 8:81403087-81403109 CAGGAGGATGAAAGGACCTGGGG - Intergenic
1044335904 8:90984984-90985006 GGCGAGGAAGAGAAGCTCTGAGG - Intronic
1044625936 8:94235051-94235073 GGGGAGGGAGAGGGGCCCAGAGG + Intergenic
1045242107 8:100411618-100411640 GAGGAGGAAAAGAGGGACAGAGG + Intergenic
1045407613 8:101882371-101882393 GAAGGGGAAAAGAGACCCTGGGG - Intronic
1046001974 8:108432419-108432441 GAGGAAGAAGAGAGACCCAAGGG + Intronic
1046075181 8:109304825-109304847 GAGGAGAAAAACTGGCCCTGAGG - Intronic
1046521480 8:115331227-115331249 GAGGGTGAAGAGAGGACATGAGG - Intergenic
1046538991 8:115554864-115554886 GAGGGAGATGAGAGGCCCGGGGG + Intronic
1047206985 8:122810534-122810556 GAGCAGGAAACGCGGCCCTGAGG + Intronic
1047411164 8:124625900-124625922 GGGGAGGGAGAGAGGCAGTGGGG - Intronic
1048005508 8:130416286-130416308 GAGGAGGAAGAGACGGAGTGTGG - Intronic
1048054891 8:130853754-130853776 GAGGTGAAAGACAGGCCATGTGG + Intronic
1048296753 8:133220441-133220463 GAGGAGGAACAGAGGCACAAAGG - Intronic
1048426576 8:134329114-134329136 GAGGAAGAAAGGAGGGCCTGGGG - Intergenic
1048752705 8:137697962-137697984 GATGAGGAAGAGAAGCCCAAGGG + Intergenic
1048761948 8:137804952-137804974 GAGGAGGGAGAGAGGGACCGAGG + Intergenic
1049034330 8:140062511-140062533 GAGGAGTAAGAGGGACCCAGAGG - Intronic
1049090511 8:140510848-140510870 GAGGACGAAGAGCTGCCCTGAGG - Intergenic
1049097542 8:140557862-140557884 CAGAAGGACGAGAGGGCCTGTGG - Intronic
1049106977 8:140620141-140620163 CAGGAGGAAGAGGGGCCTTCAGG + Intronic
1049282037 8:141754433-141754455 GAAGAGGATGAGAGGCCCATGGG + Intergenic
1049289093 8:141792068-141792090 GAGGAGGCAGAGGGGCAGTGTGG - Intergenic
1049386094 8:142343851-142343873 GAGGAGGAGGAAAGTCACTGTGG + Intronic
1049406664 8:142454656-142454678 GATGAGGAAAGGAGGCGCTGGGG - Intronic
1049424434 8:142531817-142531839 GAGGAGGAAGAGAGTCCAGGAGG + Intronic
1049551324 8:143261300-143261322 GGGGAGGAAGATGGGCCCTGGGG + Intronic
1049764961 8:144350893-144350915 GAAAAGGCAGAAAGGCCCTGGGG - Intergenic
1049936197 9:504118-504140 GAGGAGGTACAGAGGCGCTGGGG + Intronic
1050055790 9:1652552-1652574 GAGGTGCAAGAGAGCCCCTGTGG + Intergenic
1050620702 9:7449296-7449318 GAGCAGGAAATTAGGCCCTGGGG + Intergenic
1051154332 9:14123842-14123864 TAGGAGGAAGAGGGGCAATGTGG - Intronic
1051364982 9:16315510-16315532 GAGGTTCAGGAGAGGCCCTGAGG + Intergenic
1051774793 9:20621982-20622004 GAGGAGGGAGGGAGGCGCGGGGG + Intronic
1052109018 9:24556912-24556934 GAGGATTAAGAGGAGCCCTGTGG - Intergenic
1052206134 9:25843071-25843093 ATGGAGAAAGAAAGGCCCTGGGG - Intergenic
1052324423 9:27202139-27202161 GATGAGAAAGAGATGCCTTGAGG - Intronic
1052814672 9:33092277-33092299 GAGGAGGAGGAGAGGGACAGAGG - Intergenic
1052864464 9:33456729-33456751 GAGGAGGAAGCGAGGCCAGATGG + Intergenic
1052885825 9:33647332-33647354 GATGAACAAGAGAGGCCATGAGG + Intergenic
1053299060 9:36935921-36935943 GTGGAGGAGTGGAGGCCCTGGGG - Intronic
1053449301 9:38179914-38179936 CAGGAGGAACGGAGGCTCTGGGG + Intergenic
1054981235 9:71209340-71209362 GAGGTGGGAGAGAGGCAATGAGG + Intronic
1056128476 9:83561328-83561350 GATGAGGAAGGGAGGCTCAGTGG - Intergenic
1056953321 9:91063128-91063150 GAAGAGGGAGAGAGGTCCAGTGG - Intergenic
1057146130 9:92760579-92760601 GTGGGGAAAGAGAGGCCCAGCGG + Intronic
1057263009 9:93596585-93596607 TAGCAGGAAGAGAGGCTGTGTGG + Intronic
1057353448 9:94318262-94318284 GGGCAGGAAGGGAGGGCCTGGGG - Exonic
1057557563 9:96100018-96100040 GAAGAGGGAGTGAGGCCCTGTGG + Intergenic
1057654303 9:96939330-96939352 GGGCAGGAAGGGAGGGCCTGGGG + Exonic
1057725490 9:97565183-97565205 GAGGAGAAACTGAGGCCCAGAGG - Intronic
1057813179 9:98273475-98273497 GGGGTGGAAGTGATGCCCTGAGG + Intergenic
1058226019 9:102365128-102365150 GGCGTGGAGGAGAGGCCCTGTGG + Intergenic
1059198718 9:112395068-112395090 GAGGAGGAAGAGAAGAACAGAGG + Intronic
1059427889 9:114232415-114232437 AAGTGGGAAGACAGGCCCTGGGG + Intronic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1060840843 9:126792035-126792057 GGGGAGGCAGAGAGGATCTGTGG + Intergenic
1061081049 9:128370553-128370575 GAGGAGGACAAAAGGCCCAGAGG - Intergenic
1061108658 9:128552043-128552065 GAGCAGGAAGAGACGCACTCGGG + Intergenic
1061178714 9:129011915-129011937 CAGGAGGTGGAGGGGCCCTGGGG + Intronic
1061291841 9:129654910-129654932 AGGGAGGAAGGCAGGCCCTGAGG + Intergenic
1061394010 9:130333429-130333451 GAGAAGCAAGAGGGGCCCAGGGG - Intronic
1061475418 9:130862527-130862549 CAGCAGGTACAGAGGCCCTGAGG + Intronic
1061615177 9:131774621-131774643 GGGGAGGGAGTGGGGCCCTGGGG - Intergenic
1061666720 9:132164326-132164348 GGGGAGGCAGCGAGGCCCGGAGG - Intronic
1062008065 9:134251491-134251513 GAGGAGGAGCAGAAGCCCCGCGG - Intergenic
1062044124 9:134417409-134417431 GATGAGCCAGAGAGGTCCTGGGG + Intronic
1062247367 9:135576106-135576128 GAGAAGGGAGGGAGGCTCTGTGG - Intergenic
1062555945 9:137113537-137113559 GAGGAGGAAAAGAGGAAATGGGG - Intronic
1062596153 9:137300717-137300739 GGCGGGGGAGAGAGGCCCTGGGG + Exonic
1062621038 9:137422828-137422850 GCGGAGGAGGGCAGGCCCTGCGG + Intronic
1062635791 9:137490471-137490493 GAGAAGCAACAGAGGCCATGAGG + Intronic
1185539504 X:891187-891209 GAGGAGAGAGAGAGCCTCTGGGG - Intergenic
1185688331 X:1948454-1948476 GAGGAGGAAGAGAGGGGAGGAGG + Intergenic
1185688609 X:2133976-2133998 GAGGAGGAAGAGAGGGGAGGAGG + Intergenic
1185954900 X:4478486-4478508 GAGGATGAAGAGAGGCCATAGGG + Intergenic
1186487528 X:9945015-9945037 GAGGAGGTGGACAGGCCATGTGG - Intronic
1186611553 X:11142816-11142838 CAGAAGGGAAAGAGGCCCTGTGG + Intronic
1186904570 X:14097598-14097620 GAAGAGAAAGAGAGACCTTGAGG - Intergenic
1187013386 X:15302565-15302587 CAGGAGGAGGAGAGGCAGTGAGG + Intronic
1187056272 X:15744048-15744070 GAGGATGAAGTCAGGCCCTCTGG + Intronic
1187200441 X:17129144-17129166 GAGGAGGAAGAGAACCACTGAGG + Intronic
1187928927 X:24276208-24276230 GAGGAGGAAGAGAGAGCAGGGGG - Intergenic
1188111619 X:26200642-26200664 CATGAGGAAGAGAGAGCCTGAGG + Intergenic
1189370114 X:40421219-40421241 GTGGAGGGAGAAAGGCCCTGGGG - Intergenic
1189732252 X:44033700-44033722 GCGGAGGAAGAAGAGCCCTGAGG + Intergenic
1190330602 X:49233065-49233087 GATGAGGCTGAGAGGCCATGGGG + Intronic
1191713264 X:64175262-64175284 GAGCATGTAGAAAGGCCCTGTGG + Intergenic
1192363936 X:70455540-70455562 GAGGCAGGACAGAGGCCCTGGGG - Intronic
1192478398 X:71463924-71463946 GAGGAGGAAGAGCAGCGCTCTGG + Exonic
1192795441 X:74421447-74421469 GAGGAGGAGGAGAGGGCTCGAGG + Exonic
1193389988 X:80914561-80914583 GAGGAAGAAGAGGGGTCCAGAGG - Intergenic
1195251359 X:103051375-103051397 TATGGGGAAGAGAGACCCTGGGG + Intergenic
1195872345 X:109499528-109499550 GTGGAAGAAGAGATGGCCTGAGG - Intergenic
1195964691 X:110419281-110419303 GAGCACGAACAAAGGCCCTGGGG - Intronic
1198020723 X:132655269-132655291 GAGGAGGGAGAGATGCCCTCAGG + Intronic
1198283905 X:135171264-135171286 AAGCAGGAAGTGAGTCCCTGAGG - Exonic
1198451336 X:136769014-136769036 GAGGAGGAAGAGAGGGAAGGAGG + Intronic
1198963153 X:142203767-142203789 GAGGAGGAGGAGGTGCCCTCTGG - Exonic
1199383101 X:147193441-147193463 CAGGAGGAAGAGAGAGGCTGGGG - Intergenic
1199606390 X:149582977-149582999 GAGGAGGAAGCGCCTCCCTGAGG + Exonic
1199632732 X:149786391-149786413 GAGGAGGAAGCGCCTCCCTGAGG - Exonic
1200003680 X:153074321-153074343 GAGGAGGAGAGGAGGCCCCGGGG - Exonic
1200004043 X:153075688-153075710 GAGGAGGAGAGGAGGCCCCGGGG + Intergenic
1200116246 X:153770959-153770981 AAGGAGGCAGGCAGGCCCTGGGG - Exonic
1200650350 Y:5833327-5833349 TTGGAGGAGAAGAGGCCCTGTGG - Intergenic
1200707030 Y:6451867-6451889 CAGGATGAAGTGAGGCACTGCGG - Intergenic
1200917658 Y:8585480-8585502 CAGGAGGAAGGGAGGCAGTGAGG + Intergenic
1200933999 Y:8722410-8722432 CAGGAGGAAGAGAGGCAGTGAGG - Intergenic
1200936725 Y:8744813-8744835 CAGGAGGAAGGGAGGCAGTGAGG - Intergenic
1200962523 Y:9008435-9008457 CAGGATGAAGGGAGGCCATGAGG + Intergenic
1200985040 Y:9295115-9295137 GAGGATGAAGGGAGGCAGTGAGG - Intergenic
1201027082 Y:9712841-9712863 CAGGATGAAGTGAGGCACTGCGG + Intergenic
1202177914 Y:22114603-22114625 CAGGATGAAGGGAGGCCGTGAGG - Intergenic
1202213447 Y:22471792-22471814 CAGGATGAAGGGAGGCCGTGAGG + Intergenic