ID: 1165336380

View in Genome Browser
Species Human (GRCh38)
Location 19:35172965-35172987
Sequence TCTGGACGCCAAGGCTCGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165336380_1165336386 25 Left 1165336380 19:35172965-35172987 CCACTCGAGCCTTGGCGTCCAGA No data
Right 1165336386 19:35173013-35173035 GACGTAATTGACCACACGTGTGG No data
1165336380_1165336384 -10 Left 1165336380 19:35172965-35172987 CCACTCGAGCCTTGGCGTCCAGA No data
Right 1165336384 19:35172978-35173000 GGCGTCCAGAGTTTTTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165336380 Original CRISPR TCTGGACGCCAAGGCTCGAG TGG (reversed) Intergenic
No off target data available for this crispr