ID: 1165337395

View in Genome Browser
Species Human (GRCh38)
Location 19:35181012-35181034
Sequence TGGGATCCTGAAAATTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165337384_1165337395 25 Left 1165337384 19:35180964-35180986 CCTCACAGGGTCTTTTTTGTTAA No data
Right 1165337395 19:35181012-35181034 TGGGATCCTGAAAATTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165337395 Original CRISPR TGGGATCCTGAAAATTGGGA TGG Intergenic
No off target data available for this crispr