ID: 1165338087

View in Genome Browser
Species Human (GRCh38)
Location 19:35187286-35187308
Sequence GAGGTGCCTGCCAGCACGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165338087_1165338096 28 Left 1165338087 19:35187286-35187308 CCTGGCGTGCTGGCAGGCACCTC No data
Right 1165338096 19:35187337-35187359 AAGATAATCCCCTTGAACCTGGG No data
1165338087_1165338089 -5 Left 1165338087 19:35187286-35187308 CCTGGCGTGCTGGCAGGCACCTC No data
Right 1165338089 19:35187304-35187326 ACCTCTAATCCCAACTACTCGGG No data
1165338087_1165338092 4 Left 1165338087 19:35187286-35187308 CCTGGCGTGCTGGCAGGCACCTC No data
Right 1165338092 19:35187313-35187335 CCCAACTACTCGGGAACCTGAGG No data
1165338087_1165338088 -6 Left 1165338087 19:35187286-35187308 CCTGGCGTGCTGGCAGGCACCTC No data
Right 1165338088 19:35187303-35187325 CACCTCTAATCCCAACTACTCGG No data
1165338087_1165338095 27 Left 1165338087 19:35187286-35187308 CCTGGCGTGCTGGCAGGCACCTC No data
Right 1165338095 19:35187336-35187358 CAAGATAATCCCCTTGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165338087 Original CRISPR GAGGTGCCTGCCAGCACGCC AGG (reversed) Intergenic
No off target data available for this crispr