ID: 1165338088

View in Genome Browser
Species Human (GRCh38)
Location 19:35187303-35187325
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165338082_1165338088 23 Left 1165338082 19:35187257-35187279 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 1165338088 19:35187303-35187325 CACCTCTAATCCCAACTACTCGG No data
1165338087_1165338088 -6 Left 1165338087 19:35187286-35187308 CCTGGCGTGCTGGCAGGCACCTC No data
Right 1165338088 19:35187303-35187325 CACCTCTAATCCCAACTACTCGG No data
1165338081_1165338088 24 Left 1165338081 19:35187256-35187278 CCCCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1165338088 19:35187303-35187325 CACCTCTAATCCCAACTACTCGG No data
1165338083_1165338088 22 Left 1165338083 19:35187258-35187280 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1165338088 19:35187303-35187325 CACCTCTAATCCCAACTACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165338088 Original CRISPR CACCTCTAATCCCAACTACT CGG Intergenic
No off target data available for this crispr