ID: 1165338090

View in Genome Browser
Species Human (GRCh38)
Location 19:35187305-35187327
Sequence TCCCGAGTAGTTGGGATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 551818
Summary {0: 11, 1: 1790, 2: 56608, 3: 231362, 4: 262047}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165338090_1165338095 8 Left 1165338090 19:35187305-35187327 CCTCTAATCCCAACTACTCGGGA 0: 11
1: 1790
2: 56608
3: 231362
4: 262047
Right 1165338095 19:35187336-35187358 CAAGATAATCCCCTTGAACCTGG No data
1165338090_1165338096 9 Left 1165338090 19:35187305-35187327 CCTCTAATCCCAACTACTCGGGA 0: 11
1: 1790
2: 56608
3: 231362
4: 262047
Right 1165338096 19:35187337-35187359 AAGATAATCCCCTTGAACCTGGG No data
1165338090_1165338097 12 Left 1165338090 19:35187305-35187327 CCTCTAATCCCAACTACTCGGGA 0: 11
1: 1790
2: 56608
3: 231362
4: 262047
Right 1165338097 19:35187340-35187362 ATAATCCCCTTGAACCTGGGAGG No data
1165338090_1165338100 18 Left 1165338090 19:35187305-35187327 CCTCTAATCCCAACTACTCGGGA 0: 11
1: 1790
2: 56608
3: 231362
4: 262047
Right 1165338100 19:35187346-35187368 CCCTTGAACCTGGGAGGCAGAGG 0: 423
1: 19465
2: 58168
3: 109530
4: 133258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165338090 Original CRISPR TCCCGAGTAGTTGGGATTAG AGG (reversed) Intergenic
Too many off-targets to display for this crispr