ID: 1165338092

View in Genome Browser
Species Human (GRCh38)
Location 19:35187313-35187335
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165338087_1165338092 4 Left 1165338087 19:35187286-35187308 CCTGGCGTGCTGGCAGGCACCTC No data
Right 1165338092 19:35187313-35187335 CCCAACTACTCGGGAACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165338092 Original CRISPR CCCAACTACTCGGGAACCTG AGG Intergenic
No off target data available for this crispr